Basic Information

Symbol
CNR2
RNA class
mRNA
Alias
Cannabinoid Receptor 2 CB2 Cannabinoid Receptor 2 (Macrophage) CB-2 CX5 CB2A CB2B HCB2
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_001841.3
Sequence length
5265.0 nt
GC content
0.4784

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2001.30 kcal/mol
Thermodynamic ensemble
Free energy: -2088.72 kcal/mol
Frequency: 0.0000
Diversity: 858.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.((...((((((((...((((.(((.....((((..((...((((.((((((((......(((((((((((.........)).)).)))))))((.(((((((.(((((((((...(((((((((((.(((..((((((((((((((...(((((..((...(((((..((..(((.((.......)).)))))..))))).))..)))))))))))))..(((....)))...........)))))).)))...)))))...))).))).)))))))))...(((((.((((((....)).)))).)))))..))))))).))...........)))))))).).)))...))))))...)))))))))))))))...)).)...((((((((((......)))))))))).((((((((((.(((((((((((.(((((((((((.....)))))...))))))))))))))(((((.....))))).((((((((.((.....(((..(((((...))))))))....)).))))).)))(((((((((((.......((((((....(((((.......((......)).......)))))((((.((.(((((....((((((.(((((((((.((((((......(((((((...(.((((((((((.((((((((((......((((((((((((.........((.((.....)).))...(((((((..((((((.(((((((....((((((((((((((((................((((..(.((((((((((((((((((((..((((((((.....)))))))).......((((((((.((((..(((((.(((((((((.(.(((.(((((.(((((.((.....((((((((....((((.(..((.........))..).)))))))))))))).))))).)).((((((.((((......)))).))))))..(((((((....))))))).)))))).)...)))))))....))...)))))..)))).))))..))))....((((((((....))))))))((((((((....(.(((.((.((((......)))).)).))).)...)))).))))(((..........)))........(((.(((.....))).))))))))))(((.......)))..))))...))))))))).)..).)))..((((((.((((((((.....................))))..)))).))))))........))))))))))).)))))..((((((...((((((..........(((((((((.(((.((..((((((......)))).)).)).))))))))))))....(((.....)))..((((((((((..((.(((.......))).))...)))))))))).))))))..))))))(((((............))))))))))))))))))...)).)))))(((((.....))))).......)))))....)))).)))..))))))..))))..))))....)))))).).)))))))...)))))).))..((((.((((((..((((.((((((((((((((.(((.(.((((((..(((((((((...((.((...(((..((((((..((((...((.(((.((((((......)))))))))..))...))))..)))).))...))))).))...)).)))))))..)))))).)(((((((....(((.(((.........(((((......)))))))))))......)))))))..)))..))))))))))))))..)))).(((((......)))))(((((......))).))((((((((((.(((((............((((((((..((.....))..))))))))..((((((((((((..((....)))))))))))))))))))...))))))))))..(((...............)))..((((((.....(((((.....)))))...........((((...((((((...(((..(((((((.((((((((.(((...........................))))))))))).((((((((..((((((((.....))))))))..)))))))).(((....)))...(((((.....)))))....(((((...)))))..((((((..((..((((.(((((((((((((((((.(((((((((((((((.((((..((((((((((.(((((((((((((((((((((((((((.((((((((((((((..(((((((((((((.(((((((((((((((.((((((((((((.((.((((((((((((((((((..(((((((((((.((((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((..(((((((.(((((((((.((((.((((.(((...((((((((((((.......))))(((((((((((((((((...)))))))).......((((((((......))))))))(((((((.((((((.((((..((((((.........)))))))))).....((((((..((((((.((.(((.......((((((.(...........)))))))......))).)).)).)))).))))))......(((((....))))).((((((((....)))).))))......((........))((((((((((((........)))))..)))))))...(((((((((...((((((............((((((((((....((((.((.(((.((.(((((............(((((((((.((((((.(((((((((....))))))....(((((((..((....((((..(((((((((.......))))))........((((..((((((((((((((((....(((.....)))...)))))..((((....)))).........((((((.......)))))).......(((((((((.................)))))..))))..)))).)))))))..))))(((((((.((((.....)))))))))))(((((((((...((((.((.........((((...........)))).((((.((.(((((.(((((....((.((((.(((((....((((((...(((((((......))))))).))))))...)))(.(((((...(((((...((((((....))))))....)))))))))).)...................))))))))..)))))))))).)).))))............))))))..)))))))))...(((..(((((((((..(((((.......((((....((((((......))))))....))))........))))).)))))))))..))))))..)))).....))..)))))))..)))))))))....)))))))))))))).))))))))))).)))))))))).................(((((.....)))))....))))))))))))))).((((((((((......))..))))))))......((((...))))....)))))).))))))).)))))))))...((((((((......(((....)))......))))))))..............(((((((((((((((....(((((((...(((..((...((((((..((((....((((.((((((.((((((.((.(((.....((((((.((((....)))).........))))))(((((((((((...)))).))))))).....(((((.(((....))).)))))....((.(((....)))))................((((((.((((((.((((....)))).))))....))))))))...))).)).))))..))...)))))))))).....(((((((((((.(((((................))))))))))))))))....))))..)))))).))..)))...)))))))))))))).(((((((...(.(((((((((((((.((.........)).))))).)))..)))))).)))))))..(((((((..((...............(((((...((.(((((((.((((........(((((......))))).......)))).))))))).)).)).)))......((((..((((((.(((((((((((....(((............)))..))))))))((...(((((((((....((((...((((((.....((((.......))))..(((((.((.......)).)))))))).)))...))))...)))))))))...))......))).))))))....)))).))..)))))))))))))))..(((......)))........))).))))).....))).)))).)))).))))))))).))))..)))..))))))))))))))))))))))))))))..)))))))))))))))))))))))))))))))).)))))))))))))))))))).)))))))))))..)))))))))))))))))).)).)))))))))))).))))))))))))))).)))))))))))))..)))))))))))))).))))))))))))))))))))))))))).))))))))))..)))).))))))))))))))).))))))))))))))))).))))..))..))))))...((((((((.......))))))))......)))))))..)))...))).)))..)))).....))))))...)))))).))))....(((((((((.(.....).)).)))))))(((((((.(((((((.(..(((.((..........)).))).).))).......((((...))))......)))).))))))))))))))..)))))).))))).)))))))))))).......))))))).))))....((.((((((((.((..(((......))).)).))))).))).))...(((.....)))..))))))))))))).......................
Thermodynamic Ensemble Prediction
{.({...((((((((...((((.(((..,,.((((..(({..((((.((((((((......(((((((((,{...{{{...))})).)))))))((.(((((((.(((((((((...{{,((((((((.(((..(((({{((((((((...{((((..,{{,.(((((..,,{,(({.{,.......))})},.,..))))).))..)))))))))))))...,,....||{(({....}))})))))).)))...)))))...))).,}).)))))))))...(((((.((((((....)).)))).)))))..))))))).)),,.....},..)))))))),).))}}}},,))))}..))))))))))))))).,.}},}.(({(((((((((......}))))))))},((((((((((.{{(((((((((.(((((((((((.....)))))...)))))))))))))){({((.,,,,|}}},.|{{|||{(.({.....{((..(((((...)))))))),..,||,|}}}}.|||({({(((((((.......((((((,...{{{{{.......,..||,..|||......)))))((((.((.(((((....((((((.(((((({{(.((((((......(((((((...(.((((((((((,(((,{,,,||}}}}}.(((((((((((({{.......{{.{{.....}}.,}...((((((({.((((((.(((((((....((((((((((((((((...............,(({..,(.({{{(((((((((((({{{{|||{||||,(,,,{(((((|||},,|||,}|||(((((.((((..(((((.(((((((((.(,(((.(((((.(((((.({....,((((((((,{(((..,.({.{{......,..)),.}))))))))))))))).))))).)).((((((.((((......)))).))))))..(((((((....))))))).)))))).),..)))))))....))...)))))..)))).))))}..}},,,.,((((((((....)))}))||((((((((...,{.(((.((.((((......)))).)).))).)...)))).))))||{..........))|({{....((((.(((.....))).)))).}..)))).....,,,)))))))))),})}}||||||......,,},,|||{{|,||||||{|,,,...,.,............))),.,}}}).,}}}}}........))))))))))).))))),.(((((({{{((((((,.........(((((((({{(((,{(..(({(({......}})),)).,).))))))))))))....{{{,....}}}..((((((((((.,((.(((.......))).)).,.)))))))))).))))))).))))))(((((............)))))))))))))))))).}.)).)))))(((((.....)))))....}}.)))))....)))).)))..}||}}|{{,}}},,)}},}}.,)))))).}.)))))))...)))))).)}..((((.((((((..((((.((((((((((((((.(((.(.((((((..(((((((((...((.,,.,.(((..((((((..((((...((.(((.((((((......)))))))))..))...))))..)))).))...))),}.))...)).)))))))..)))))).}(((((((,...,,|,|{{{{{{{{({.(((({......))))).,,,))}})}}})))))))..))),.))))))))))))))..)))).(((((......)))))(((((......))).))((((((((((.(((((............((((((((..{{.....}}..))))))))..((((((((((((..((....)))))))))))))))))))...))))))))))...,,................((,,(((.,..(((,...})))..,.))))))...,,,.,,((((...((((((...(((..(((((((.((((((((.(((..,(,{{,....,,,},.,..,.}...))))))))))).((((((((..((((((((.....))))))))..)))))))).(((....)))...(((((.....)))))....(((({...}))))..((((((..((..((((.(((((((((((((((((.(((((((((((((((.((((..((((((((((.(((((((((((((((((((((((((((.((((((((((((((..(((((((((((((.(((((((((((((((.((((((((((((.((.((((((((((((((((((..(((((((((((.((((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((..(((((((.(((((((((.((((.((((.(((...((((((((((((.......))))(((((((((((((((((...)))))))).......((((((((......))))))))(((((((.(((((((.,((....))..))))}}|{{((((({{({,.,{{,((((((..((((((.{(.(((.,,....((((((.{............))))))...,,.))).)}.)).)))).)))))),,,...{{{{{....|}|||{,.,|||||},,,.)))}))))})},,,||,.......,,((((((((((((........)))))..)))))))...(((((((((...((((((......,..,,.(((((((((,....((((.((.((,,((.((((((,.,{.,,,...,{(((({({.{(((((.{,.((((((....))))))....(((((({..{,,,},||{{{,({,((((((.......))))))........((((..((((((((((({((((,...{,,.,,,,,||...}}}},..((({....}))}.........((((({.......}})))).......|||||{||{,.......,,,}},...)))}},,}},,..)))).)))))))..))))(((((((,{(((.....))))))))))){((((((((...((((.{{.........{{{{.......|,..}}|}.((((.((,(((((.(((((....((.((((.,((((....((((((...(((((((......))))))).))))))......{.(((((...(((((...((((((....))))))....)))))))))).,{{{.,......,.}},.,}))))))))..)))))))))).)),))))............)}))))..))))))))}..,(((..(((((((((..(((({.......{(((,{.{((((({......}))))).,,,)))}........))))).)))))))))..)))))}.,|}|}.....}}..))))))}..}}})))))),,,,)))))))))))))).))))))))))).}))))))))).,,..............(((((.....)))))...,))))))))))))))).((((((((((......))..)))))))},|,,..{{{,...))))....}}}}.,.))))))).))))))))).,.((((((((......(((....)))......)))))))).,............(((((((((((((((....(((((((...(((..((...((((((..((((....((((.((((((.((((((.((.(((.....(,(((({({{..,..{{{.{{{..,,..,||||}(((((((((({...})))},))))))...}}||{{,.|||,.,,)}),))))),,.,||,{{{....}}},,,,,,,.....,,,,,.((((((.((((((.((((....)))).))))....))))))))...))).)).))))..))...))))))))))...,.(((((((((((.(((((................))))))))))))))))}}..))))..)))))).))..)))...)))))))))))))).(((((((...{.(((((((((((((.({.........)).))))).)))..)))))}.)))))))..(((((((..{{...,{{{{,,,,...({{{,...{{.(((((((|({{(.,,....,{((({....,,}))}}.......}}}},}}}))}).}}.}}.|||,....||||,..,,,,{{,,,,((((((((....(((............)))..))))))))..,,,((((((((({{{,((((....|}|{|},...((((.......))))..(((((.((.......)).)))))|||,....,,))},}),}))))))))...,|{{,.....},}),}}}},,.,,,,,}}..)))))))))))))))..{{{......)))........)))}}})))...,})},,)))}.)))}.))))))))).))))..)))..))))))))))))))))))))))))))))..)))))))))))))))))))))))))))))))).)))))))))))))))))))).)))))))))))..)))))))))))))))))).)).)))))))))))).))))))))))))))).)))))))))))))..)))))))))))))).))))))))))))))))))))))))))).))))))))))..)))).))))))))))))))).))))))))))))))))).))))..))..))))))..,((((((((.......)))))))).,....)))))))..)))...))).)))..))))....,}........)))))).))))....{((((((((.(.....).))}))))))|(((((((.((((,(,...{((({((........,,}|,|,,...))}.,,....,,,|}}}))),......)))).))))))))))))))..)))))).))))).)))))))))))).......))))))).))))...,||||...,,,..,({{(((.,.{{{|.,.)),),,)))))).,,.,,,,...,}}),,..}}}))))))))))...,,....,.............

Transcripts

ID Sequence Length GC content
GGCACUCAACAGGUGCUCUGAGUGGCACCCACGGCCAGGUCCUGGGAGA… 5265 nt 0.4784
Summary

The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CNR2 is primarily expressed in microglia within the ventral tegmental area and its expression is tied to drug addiction and synaptic plasticity [Fan et al. DOI:10.1016/J.Jgg.2024.08.009]. In human postmortem studies, the CNR2 shows altered expression in the dorsolateral prefrontal cortex of individuals who died by suicide, with decreased mRNA but increased protein levels and increased CNR2-GPR55 heteromer protein observed [Yamamoto et al. DOI:10.3390/Ijms25115750]. A study in human fetal and adult tissues demonstrated that the CB1 cannabinoid receptor protein and mRNA are identifiable by immunohistochemistry and RT-PCR in long-term formalin-fixed paraffin-embedded tissues, confirming the method's suitability for investigating cannabis toxicity in fetal brain malformations [Blanchot et al. DOI:10.1007/S00414-026-03744-X].