Basic Information

Symbol
CNTNAP1
RNA class
mRNA
Alias
Contactin Associated Protein 1 Caspr P190 CNTNAP NRXN4 Contactin-Associated Protein 1 Neurexin IV Neurexin-4 Caspr1 Neurexin 4 CASPR CHN3
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_003632.3
Sequence length
5537.0 nt
GC content
0.5743

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2166.80 kcal/mol
Thermodynamic ensemble
Free energy: -2260.52 kcal/mol
Frequency: 0.0000
Diversity: 1324.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((..(((((((((...((((((.(((..((((.(((((.((((((((((((((((((((.((((((((((...((((((((((((((.(((..(.(((..(((.............((((((((......(((((((.((((((....(((((.((((((((((((((.(((..((.((((((.((((...((((.......((((((..(.((((((...)))))).......(((((...((((((((..((((((((((.(((((((....)).)))))..)))))..))).))..))))))))............)))))....(((((((((((((..(((((((((((.....(((((....((((((((((((((((((.(((..((.(((((...))))).............((((......))))....((((((.(((((((.(((((((..((.(((((((...(((.(((((.((...)).))))).)))..))......(((((((((((..((.(((....))))).(((....)))((((((((..........(((((((((((.((((((((.((((((((..........)))))).))(((((...........)))))((((((.......).)))))....)))))))).((((..(((..(((((((((..(((..((......))..)))..)))))))))..)))..))))(((.(.((((......((....)).......)))).).)))(((((((.(((((....)))))..)))))))................((((((((.(((((((..((((...((((((.(((..((....))..))))))))).(((((((..((((((((((((((((..........))))))).(((((((((....((.((.((((((.((....(((((..((..((((((.(((((.....(((((((((......))...)))))))))))).))))))...))....)))))..((.((((.((.(((((((.(((......)))...((((.((((...)))).))))..))).)))))))))).))......)).)))))).)).)).)))))))))......((((....))))......)))))))))..)))))))(((.....)))((((((((((((..((((((((((((......((((((....)))........(((((.((...(((........))).)).))))).........)))......))))))))))))....)))))...))))))).)))))))))))...))))))))..))))))))......)))..........))).))))).....))))))).))))))))).))......))))).)).))))))))))))).....))....)))...)))))).)))).))))))))....((((((....)))))).(((((((((....(((((((..(((((.((((.(((((.(....).))))).))))...)))))((((((((..((((((((.((.(((...))).)))))))).).)..))))))))((((((.......(((((((.((.....((...((((((((((((.(.(((..((.((.(((((((((.(((((((((((..((((((.((.((.(((..((((.(((((((((.(((((((((.....(((((((.(((((((.....))))(((.(((((.(((((.(((((((((((....))))))).))))..((((.(((.(.....).))).))))...))))))))))))).))))))))))..((((((((..(((.(((((.((((((((((((.(((......((((((((.(((.(((((....))))).)))..))))).)))((((.......))))((((((((....))))).))).(((((((.(((......)))(((.((((((((.....)))).....)))).)))(((((((.((((((((((.............))).))))))).)).)))))..)))))))..))).)))))............))).)))).))))).))).))))))))..((((((.((((((...((.((((((......(((((....(((((((..((((((((((..((((((((((..((((....))))..)).))))))))))..(((((((((((((.(((((((....)))))))....(((.(((......))).)))............(((((((..(((((.(((.((...))))).))).((((((.....))))))))..)))))))..(((((((((((((((...((((((((...)))).)))).)))).(((((.((..((..((.((((((((........)).)))).)).))..))))))))).)))))))))))......)))))).).)))))).((((((..((..(((((((.....)))))))......))..)))))))))))))).....(((((((((......))).))))))..((((.....))))..........)))))))..)))))...))))))))((((..((.....))..))))......))))))...))))))(((((.((........)))))))((((((((......))))))))))))))))))))))))))..))))..))).(((.((((..((((.(((.(.((((((..........)).)))).)))).))))..)))).)))..)).)).))))))..))))....(((((....(((((((....)))))))....)).)))((.(((((((.(((.(((((((....(((...)))....)))))))..))).)))..))))))))))))).))))))(((....))).((((((((((((((..(((.((.((.......)))).)))))))))).)))))))......((((......))))((((((..(((((((((((((.((.(((((((.((((...(((..(((..((((.(.((((..(((...((((((.............((((((....))))))..)))))))))..((.((....)).)).((.(((((.((.(((.(...(((((..((((((((.(((((((.((.(((((((...((((((((.(((...((((((.......))))))......(((((((((((((................)))((((((((((.....)))))..((((....))))....)))))(((((((((.(((.(((((((((((.(((.((((((((((.........))))))..))))))).))))..))))))).((((((.....)))))).........))))))))))))..))))))))))...)))))))))))......(((((((((((((((.(..(....(((..(((((...((...))...)))))....)))....)..).))))))).)))))))).....)))))))(((((((....)))))))......((((((......)))))))))).)))))..))))))))..)))))..).))).))))))).))..))))).))))..)))..)))...))))))))((((((((((.........))).)))))))......((((((((((.(.(((...)))).))))))))))........((((......)))).((((((....))))))(((((.((((....((.(((...))))).....)))).))).))((((((.(((((..........)))))...))))))....)))))..))))))...))))))))))))).......))).)).)).))).).))))))..)))))).))((((........)))).......((((..........)))).)).)))))))))))))...(((((.((((((.((((((((....(((((......((((..((((..(.........)..))))..)))).))))).....))))))))...)))))).)))))((((((((((..((((((.....((((((((........(((........(((....((((((.............))))))..))))))....)))))))).((((((((....(((..............)))..))).)))))..))))))))).))))))).........)))))))......).)))))))))))))........)))))))))))(((((((((((((((.............)))))))).)).).)))).(((((.....)))))..))))))))))))).....)..)))))).........)))).)))))))))).)).((((....))))....(((.((((.((.(.((((((((((((.(((((((((........)))).............)))))))))))))))))).)).)))).)))(((.((((((...)))..))).)))..)))...))))))))).))))).)))))....))))))))).)))).((.((((((...(((....))).)))))).))......))))))))..(((.((((((((.((((((((...(......).))))((((((((((((.........))))))).......)))))..)))).)))))))).))).(((.(.((((((..(((((((((...(((((.((((((((...............)))))))))))))))))).(((.(((((.....(((((((......)))))))....)))))))).....)))).))))))).))).((((((((((((....)))))..))))))).)))..))).)..)))..)).)))))))).))))....(((((....)))))..........(((((...............))))).....(((......)))..))))).)))))...)))))))........((...((((((((........))))))))..))..((((........)))).))))))))))))))))).(((((((((((..........((((((((.((((.......))))))))))))..))..))))))))).(((((...)))))(((((((..(((((.........)))))..)).)))))..((...(((.((...(((......))).)).)))...)).).))).)..))).))))))...))))))).)).....))))))...(.((.((((((.....))))))..)).).(((((((((((((.((((((......))))))(.(((((.......))))))............)))))))).)).)))...
Thermodynamic Ensemble Prediction
.....(((((((.((((((({,{,{{(((.((((((((((((((((,.(((((.(((((((((..((..,(((.,,,,({(.((((((((((((((.(((..,.(((..(((.,.,,,.......((((((((.{{{,{({{,(({,((((((....(((((.((((((((((((((,(((..((.((((((.((((.{{(,,{.......((((((,,(.((((((...)))))).....,,|(((({{{((((((((.,(((({(((((.(((((((....)).)))))..)))))..})),)}..))))))))..,,,|,.,,,|||,,|..,,(({{{{{(({({{{.(((((((((((.....(((((.,..((((((((((((((((((..({.,({.,((,,...,||||{............,{{{......}}})}}}}((((((.(((((((.(((((((..((.(((((((...(((.(((((,((...)).))))).)))..))......(((((((((((..((.(((....))))).(((....)))((((((((..........(((((((((((.((((((((.{(((((((...{,...},)))))).)}(((((...........)))))((((({.......).)))))....)))))))).((((..(((..(((((((((..(((..((......))..)))..)))))))))..)))..))))(((.,,(({,.,,...}}}.}.)))..,.{{||||{|.{||,{((((,.,{{||,,,.))}},..))))))).....,,......,..((((((((.(((((((..((((.,.(((({{.{{(,.((,,,,||,,}}||}|||},({{{{||,,|{|||||||(((((((..........))))))).{((((((((....((.((.((((((.((.{{{(({,({{({,.((((((.(((((.....(((((((((......))...)))))))))))).))))))...},...{|||}|.,,..{|||,{{{(,(((.({(((......,|||.|(((|.{{,{...)))).))))}.,,)}))),)))))),}}},....)).)))))).)).)).))))))))},,,...((((...,)))}....,.))))))))}..}||||}},,,...,}))}((((((((((((..((((((((((((..{...{{{(((....)))........(((((.((...(((........))).)).)))))........,)))..,,..))))))))))))....))))}..,))))))),)))))))))))...))))))))..))))))))......)))..........)))}})))).....))))))).))))))))).))......)))))},).))))))))))))).....}}....))),..)))))).))))})}))))))....{{{{{{,.,,||||},.(((((((((...{((((((((.(((((.((((.(((((.(....).))))).))))...)))))((((((((..((((((({{((.(((...))}.)))))))).).)..))))))))..((((((((.....((((((.(((...,,{{{{.,{,{{{,}}},})}}|,|((((({(((((...((((((.(((.((.....(((((.{,,..((.(((((.((.((((...(((((((((((((((((((((.(((((((.....))))(((.((((,,(((((.(((((((((((....))))))).)))|{.((((.(((.(.....}.))).))))},.))))))))))))).)))))))))}..,(((((((..(((.(((((.(((((({(((((.(((..,...((((((((.(((.(((((....))))).)))..))))).))){(((.......)))}((((((((....))))).))}.(((((((.(((......)))(((.((((((((.....)))).....)))).))),((((((.((((((((((.............))).))))))).}),))))}..)))))))..))).))))).}}},,,,,...}}}.)))).))))).))).)))))))|(((((((.,......})},))))),)))))))),({(.((((((..((((.((((....(((...(((((((((.(((((((,.(((((......,((((((({.((.(..(({({{{(((((((....))))))).}..,)).))..})).)))))))}.....))))).}(((((((..({(((.(((.((...)}))).))).{(((((.....)))))}})..))))))).....)))))))..)))))))))..)))..))))..)))).)))))).),),...)))))).)))).)).)))))))..},.}.))))))).))).)))))).)))))(((((((...,.(((((((.{....}.))))))),|...((((.(((((((((.....)))))))))}))}.....,}.)))))))...(((((((((......))).))))))..((((.....))))...........,(({,..,...))))))))))}..((((..((.....))..))))....)))))))))((((((.(((((((((....(((({({,.{(((((((((......)))))))))}...,,,},{{{{||||||{{{...,,..,|},}},|}}..||,}}}}}.,|)||}}},......)))))))))).)))))).}))))))),,.(((((((..((((({{({(...}))|,,....(((((({....}}))))).,,.,}.}},{|.|||||{({(((.(,((((({{,.{{,...}}}.{{{|||||||..||{.|{|..,)))))}.,||||||,}}|}((({,..||}.((((((((((((({.,(((.((.((.......))}),)))))))))).))))))).||...{(((......)))}((((((.....((((((((((.((((((((((((.((..((({.{.((((((((.(,({,..{{{,.{((((((,,{{{{.,,{....((((((....))))))(({(|,.(((((.((.((....)).)).)))))..}.))))(({,....,|||..,,,{({({{(,(((((.,,.}||||,,...((((((((.(((.{.((((((.......)))))).,....((((((((((,,({..{,{,,........,,)|{|||{((({{,,,.|||}}..((((....))))...,))}))||{(((({(.((((((((...}))))))).,,,.(({((((((((.,,..((((((.....)))))).},.))))))))||||{,..,..,|||||.........))}))))))))),.))))))))))...))))))))))).,,..,||,,,|||{{{{|||}}..}}},}||{..{{|||..,||...}}.,.,}))}...,)))))).))))).))))))))))).)))..))))))|{.((((((...(((((.((((((((({,((((({{{{..,||}}|((((({{{{{{{.,,||}}..,}}},...{{|{,....))))..,,,}}|((((((((((((({..........{{(,(,,,,||||,,{{{{,...|||{|,|||,|,.....((((((((((.(.(({...)))).)))))))))),.}}}}}.||||},,,.....|.((((((....)))))),|{{|,{{((,,,,((.(((...||}|},|,..}}}},}}}...{({(((.{{|||..,....)..))))),,,))}))).||..|{{..{{(((({..,,|,|,,|||.,.|{{{((({,..,{{{{,,,,...|,{{||.,,}})),},))....}})))))),)))})....}})||.,.....}},})))),,..)))}))),})),,))}||||}((((((.((((((((....{((((,..{,.((((..((((..(.........)..))))..)))).}))}),,,..))))))))...)))))).,,,.))))).)))))))))}}}}}...}))))||}}...,,,,.}},........)),..))))).))))).))).)).)))))).)}..(((({{,{.((......)).}))))))...))))....)))))),}})))))).),))))))))))).))))))).)))))))..,,...)),))))))},,}))},)))))))))),.......})}}}}}))}|(((((((((((((((.,.........,.)))))))).)).).)))))(((((.....)))))}})))))||||||,,..,}))}})))))).........))),,)})))))))).)).((((....))))....(((.((((.,,.,.((((((((((((.(((((((((........)))).............)))))))))))))))))}.}}.)))).)))(((.((((({...}}}.}))).)))..)))...))))))))).))))).)))))....))))))))),}))).||,((((((.,,({{...,))}.)))))).}}......))))))))..(({.((((((((.(((({(((,..(,.....|.}}},{{{{{{((((((.........))))))),,....,)))}}..)))).)))))))).)}).(((.(.((((((..((((((((({.{(((((,(({(((((...............)))))))))))))))))).{{{.{{{{{.....(((((((......))))))).,,,|}}}}))).....)))).))))))}}))).((((((({((({....,,}))}.))))))).)))..))).}..)))..)).)))))))).)))).))}(((((....}))))..........(((((...,........,..)))))....)})..))..))),))))))..)))))..}))),||||....,,,((,.,(({{{{((.{......}}}))))}..))..{{{|,,.,},,})})),})))))))))))).))),(((((((((((..{{......,{{((({,.,{{{.,,,...}},,,,,,,,))..)),.})))))))).,{(((...)))||(((((,{..(((((.........)))))..})}))))}.......,{||}...,))))}}}))},,,,}.}},|,|||,{{{{|{{..{((({..,{{({,{((((......))))}.},.....,.,,.((((((.....)))))).{((..((({{(((.((((((((((,({{....,,,))).}}}}.))))).).)))))))..))).....))))))))))).}))....

Transcripts

ID Sequence Length GC content
GAAACCGGCGCGUGCCAGGAGACAGAGGCUGGGGAAGGGGGGAGGUGAG… 5537 nt 0.5743
Summary

The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]

Forensic Context

A study in rats demonstrated that after spinal cord injury, the axonal protein Caspr, normally confined to paranodes, displayed a diffuse distribution along injured spinal cord axons from as early as 1 hour post-injury, a redistribution that persisted for weeks and occurred in parallel with the redistribution of Kv1.1 and Kv1.2 channel subunits [Karimi-Abdolrezaee et al. DOI:10.1111/j.0953-816X.2004.03164.x].