Basic Information

Symbol
COL15A1
RNA class
mRNA
Alias
Collagen Type XV Alpha 1 Chain Collagen Type XV Proteoglycan Collagen, Type XV, Alpha 1 Collagen Alpha-1(XV) Chain Collagen XV, Alpha-1 Polypeptide Endostatin-XV Restin
Location (GRCh38)
Forensic tag(s)
Wound age identification Drug abuse diagnoses

MANE select

Transcript ID
NM_001855.5
Sequence length
5223.0 nt
GC content
0.5426

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1957.10 kcal/mol
Thermodynamic ensemble
Free energy: -2044.72 kcal/mol
Frequency: 0.0000
Diversity: 1556.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((..(((((((((((((.(((((((((...((((.....))))))))).))))..))).))))(((((((((((((..((((.((((((.(((.((.........((.((.((.((.(((((....((((((.(((......)))...((((((...(((.((.....((((((((..((...(((.(((.(((((...(((((((..(((.((.(....(((.....)))....).)).)))...)))))))....(((((....))))).......)))))))).)))...)))))))))))).)))...((((((.((((.((((..(((((((.((.(((((........))))).))..........))))))).)))).(((((((..((((((.(.((((((((((((.(((((((((.......))))))))))))....((..(.(((((((((.......))))))))).)..))....((((((((........((((((((.(((((((((((((((.((((((....((((((.....(((((...(((((((((...)))))...))))....)))))))))))......(((((((((((......)))))))...))))(((((((.((......)).)))))))........(((((((.......)))))))..((.((...(((((.((.((((((.((((((((...((((((((((((((((((((.((((((.(.(((((..((.((...)).))..))))).))))))).(((.((.(((((.(((((((((.((....((.((..(((((((((...(((..(.....)..)))...))))))).))..)).))....))..))))))))).))))).)).)))))).)))).)).)))))))))))...)))..........(((((((............(((.........)))....((((..(((((((((((((((((....(((.((.(((....)))...))))).(((..(((..((((((......)))......((........))...((((((.......(((((((....)))))))..........(((((((((((((((((.((((..((((.((((....(((....)))....))))((((((((((((((((..((((((((........))))))))...((((......)))).(((((...(((((..((((((((((...........))))))))))..((.(((((((.(((.((((((((..((((.(((.((.((....))...(((((.(..((((((((((.........((.....)).((....))..((((((.(((((((((.(((.((((((((((((((((...((.(((((......))))).))(((..(((((((.(((.((...((.(((((.(((((......)))))((((((........))))))..((((.(((.....((((....)))).....))).)))).(((((.....)))))(((((((..(((((((((...)))))...)))).((((((((((((..((((...))))...)))).))).)))))((((((....((((..((..((....))..))...))))...))))))....)))))))....))))))))).))))))))))..))))))))((..((((((....(((((....((((((....(((.(((....((((....))))..)))..)))....)))))).......)).)))....))))))..))......)))).))))))).)))..)))))..)))))))))).....))))))))))..))))))..(((.(((((...........))))).))).((((((((((((...((((((((((((((((((.(((((..(.((((((.....)))))).).)))))..))))...((((((((((.(((((.((.(((((....))))).)).)))))...(((.....))).(((..(((..((.((.((.(.((.(......))).).)).)).)).)))..))).))))))).)))..)))).))))))))))))))).))))))))))))))))......)))).))))(.(((..(((((....)))))..))).)......((((((((((....))).)).)))))))).))))))))).....(((...((..((((((...((((((....)))))).))))))..))...)))((.(((((....))))).)).......))))).)))))..)))))))......)))))))))...))))...)))).))))))))))....)))))))......))))))....((((((.............)))))))))..)))..)))..))))))))).))))))))(((......)))(((((.((((.((..(((((((.....)))..(((((((............)))))))........(((((.(.((((.((((.((...)).)))).)))).).))))).))))..)).))))..))))).((((((..((((((....(((((((.......(((....)))))).))))....))))))..)))))).......))))....)))))))..))))).)))(((......)))..(((((((...))))))).....))))).)))))....)).))..(((((....(.(((.((((((.......)))))))))...)....))))).......((.(((..(((((((((.(((((((...))))))).)))(..(((((((((..((((.((...))..)))).)))))))))..)((.((((((..(((((((...((((.....))))....)))))))..))).))).))............)).))))..))))).....))))))..)))))).(((...)))((((....))))......)))))))))))).))))).....(((((.((((....(((.(((..((((.(((((((((..((((((((...((..(.......)..))...))).))))))))).)))))))))...)))..)))....))))))))).)))))))).......))))))))).).)))).))...)))))))....)))).))))))((((.(((((((((....((......))..)))))).((((.((.((((((..........)))))).))..)))).....((((((.(((..(((((((((..(((....(((((....)))))....))))))))..((((.((((((((.((((((..((((((((((..((((((...((((((((.((...((((((.....)).))))...))))))))))....))))))..))))))...))))..)))))).))).))))).))))....(((....)))((((((......))))))...(((((..(((((((((...(((..((((.(((...))).))))...(((((..(((((.((((.....)))))))))......(((.((((...........((((.((.....)))))))))).))).....))))).)))...))))))))))))))........))))..))).)))).))....))).))))..)))))).....(((.(((((((...)))...)))).)))....(((((((((((((((((.((...(.(((((...))))).).....((((.......)))).((((....)))).........(((................)))..((((((((...(((((((.((((.((...........)).))))))))))).((((((((((...((((..........(((((((..((.......((((((.....)))))).......))....))))))).))))))))))).)))...........)))))))).....)).)))))))))).....))))))).....))))))...))))).)).)).)).)).........)).))).)))))....).))))..)).))))..((((......)))).)))))))..(((((((.(((((...)))))(((.....)))((((((...(((((....(((((.((.((.....((......))...)).))))))).....)))))....((....)).....((((((.(((((((((....((((((((((......(((((...(((((((...(((......)))...))).))))....)))))......)))))))))).((((.....((((((((((((.((..(((((((((...............(((.((((((..........))))))))).......(((((...((.((((.((.....)).)))).))....))))).(((((..(((((((((....(((((.......((..(((((...)))))..))....)))))..............))))).))))..)))))))))))))).)).)).....))))))))))...(((((((....((((((........))))))(((((((((((((.....................(((((...((((((((((..(.((((((.......).))))).).)))..)))))))......)))))..((((((...))))))...(((((((((.......)))))))))....(((((((((.(((((((.....)))))))..............))))))))))))))..)))))))))))))))))))))))))))))))))).......((((....)))).......))))))...........)))))))..))))))..........................(((((((((((.((..(((.((..(((.((((((....(((((((...........(((.((((((.....)))))).)))...........)).))))))))))).)))....)).))))).))))...)))))))..........)))))..........
Thermodynamic Ensemble Prediction
.....{{{{(,,((((({(((((((.((((((((((,.(({{.....)}))))))).))))..)))},)))((((((((.{,{{..({((,,(((({.(((.,,.,{{{,,{{{(.{{.,(,{{.({{((.,,,(((((({(({.,,...))).|,((({{(..,{{{((......((((((,((((((((,((((((((((({.,,{(((({{{..(({((,{,{{{({(((,(((.{,{,,((((((.(((((((.((((...(((((....))))).......))))))).....)))).)))))).,,.,|{{,,,{((({{,,{,,,{|{{|,||((((,.((.(((((........))))).)).}}}}....,||||||},||||,(({{{{(,.((((((,{,({{{{{{{,(((.(((((((((.......)))))))))))).,.,{{..,.(((((((((.......))))))))).|{,|{{{{,({{,{{({.....||||((((((,.(((((({,{{{((((((((.((((......)).)).)))))))).||,.|||||},}))))}..,||||{....{,((({|{{|||..,,{((((((((((......)))))))...}}}},|||||({{(||,{{{((((((({((,.(((...(((((({......,}))))))))).,||{|.,,,...,,,,|||||.{{{.,(((,,.((((((((((((((((((((.((((({{(.(((((..((.{{...)}.))..))))).))))))).(((.((.(((((.(((((((((.(,.{.{((.((..(((((((((...(((..(.....)..)))...))))))).))..)).)).}.},},.))))))))).))))).)).)))))).)))).)).)))))))))))...,,,.......,||||{{{{{...,,.}|...,||{{...............,,,|,,||{{{{{{{{(((((((....(((.((.{({....)))...))))).{{{,,|||,,||||||,.....})}.,,||.||........}}.}}||||||.|.....(((((((....))))))),..,),,.,.|||||||{{|{{{{{{{.||||,|||{|.{{{{....|{|...,))),.,,)))){||{(({({{{{{{{,..{((((({{,,......)))}})))},,||||},.||}))})|||||||,||{|||,,|({((((({{...,,,,,..,))))))}))).|||.|{(((({.{{|.{{{||{{{..|||{.|||,|{.|||...))..|{((((.(..((((((((((.........((.....}}.((....))..((((((.(((((((((.(((.((((((((((((((({...((.(((((......)))))}))(((..(((((({,(({.,.{{{(({(,(((.{{{{{,,,,..}||||(((((({{{.,,..||}}|}..((((.(((.....((((....)))).....))).))))((((((.....)))))}.{{{({..{{{{{|{{|,..))))),,.))))}}|||||||||||..((({...})))..}))})})))})}|||(((((({,,,{{{({{{{{,|,.,.,||{({,.,,)))}...,,||||....))))}}}},.})))))))))}))))))))))..)))})))|((..((((((.,.{((({(,...((((((,{,.(((.({,.,{.((((....)))).})},..)))..}.)))))).......)).))),}.})))))).,))......)))).))))))).)))..))))}..))))))))))...,,})))))))))..}))))).}|||,||{{|,},,,....,|)))}},}}}.((((((((((((...((((((((((((((((((.(((((..{.((((((.....)))))).}.)))))..)))),.,(({(((((((.(((((.((.(((((....))))).}}.)))))..,,,(.,...,)}|(((..{((,.((.((.((.(.{{,(,.....))).).)).)).)).)))..))),))))))).)))..}))).))))))))))))))).)))))))||}|)))}},...}}))}}.,|||{.(((..(((((....)))))..}}|,|.....(((((((((((....))).)).))))))||.})|||||||.....((,.{,,(..((((((...((((((....)))))).))))))..))}..)))}}}}))||.,,|))))}|||.,,|.,,,}}}}.}}||}..|||}|},..,,}})}|}}}}}|..,}}}}||,}}}}.}}}}}}}}}}...{|||||||{{{,,.}}}}})..,}|||||{...,,,}},...,)}}}))))}..|}}..})|..}}|||||}}.||}|||||,{{,...|||||{.{{{.||(({((..(((({(({,,{{{{{..(((((((..,,....,,..)))))))........,,{{{{,...)))).....{{{((,...,,)))))|,||||||.||||{.||{||{|.((((({(((((((..((((((.{{{((,(((((....}}|||....}|||,|.||||,.,,||||||{{|||,}}.,.....||,,....,|||.}}..,))))})))))))}|{{{(((..(((((((...)))))))...}}),,}))))......,{{{{,..|||((....{.(((.((((((.......)))))))))..,,.,,,))))}.}}}...}}}}}.}))))),.,||}|||||||}}}}}))))).)),{..(((((((((..((((.((...))..)))).)))))))))..},|)),}})))),))))),,,)))))))},.|||||||||)))|}.|||||,||||{|,,...,}}}}.,|||,||,|||||||...,||}||,,...,..{{{(({...})}||||,{,..,,|,||,.,}|||},},))))}))}}}}},..|||{|,||{||,..{||.|||..{||{.|||{{{{((,,((({{{{{...||,,|......,)..)),,,}})))))))))}}.))))))})},..}|}..|||....},))},,}}|||||||||,,...{{||}}}}}}}.,.,}}}.},},})}}))))...})))}..,})))}.....})}}||..,{{{(({.{{{{{{{{.,.,.,.((((.((.((((((..........)))))).))..))))....,))))}).),))})}}|({{{{..,||,},.(((((,,..||}||....)),)))}),,||||.{{,(((((.((((((..((((((((((..((((((...((((((({,((...((((((.....))}))))...))))))))))....))))))..)))))}..,))))..)))))).))))).}||.||||....))))},.)}}||||||}},...||},,,.},|((((..(((((((((...(((..{(((.{({...,)).))))...(((((.,(((((.((((.....))))))))).....,(((,({{{.......,,,,|(((.({.....)))))}}}}}.)}},.,.}))))).}))...))))))))))))))..,,)))}})))..)))}))},,,,...}))).})),..))}}}}.,,..(((.{((({{{...))}...)))).))).,}.{((((((((((((((((.|,...{,(({({...})})}||,,...((((.......)))).((((....)))).......}|||{.....,,,........,}}..((((((((...(((((((.((((.((...........)).))))))))))).{(((((((((...((((..........(((((((..{,,,.....((((((.....))))))...,..,||....})))))),))))))))))).)))...........)))))))),,,,.))}))))))))))}....})))))),,,,.}))))),..))))),||{|,.||.}}..,,....}),.,)),})))).{{{|{,,.,..,))))),..((({......))))))))))))..(((((((.(((((...)))))(((.....)))((((((.,,(((((.,,.(((((,((.({,,,.....,}}}.,,,..}).)}))))).....))))),{{,{..||,{......((((((((((((((((,...((((((((((,,....{((((...{{({{{{..,{{(,,.,,,}}},,.}}}}})}}....})),}...,,.)))))))))).{(((,....((((((((((((.{(..(((((((((...........,,..(((.((((((..........))))))))).......(((((...((.((((.((.....)).)))).))....))))).(((((..(((((((((...,,{{{.....,{{(,{{(((({...})))).}),..}}))..,....,,........)))))}})))..)))))))))))))).)}.)).....))))))))))...,((((((...,((((((.,......))))))|((((((((((((....,................(((((...(((((((({{..{.((((((.......)}})))).}.}}}.})))))))......)))))..((((((...)))))),..(((((((((.......)))))))))..}.{{{{{{{{{.,{{{{{{.....},,,,,,....,,.,,,|...)))))))))))))).,)))))))}))))))))))))))))))))))))))......,||{{....})))...},..))))))...........)))))))..))))))..........................((((((({{((.{(,.{{(,(,,,(({.{{{{||},.|||{{(((.......,,},(((.((((((.....)))))).))},}.........,}.))))))}}}}|{||}......})))}}.))))...))))))}..........,)))),.........

Transcripts

ID Sequence Length GC content
AUUCUGCCCGCCGCCGCCGCUGCCGAGCGCCGCCUUUGUUCCCUGCAGG… 5223 nt 0.5426
Summary

This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]

Forensic Context

A study in humans demonstrated that the COL15A1 is significantly up-regulated in thermally injured skin compared to normal skin, indicating its role in the cell adhesion and extracellular matrix response during early wound repair [Greco et al. DOI:10.1016/j.burns.2009.06.211]. In mice selectively bred for differential methamphetamine consumption, the COL15A1 was overexpressed in the ventral midbrain of the low-drinking line, suggesting a potential association with extracellular matrix composition in brain reward circuitry related to addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].