Basic Information

Symbol
COL17A1
RNA class
mRNA
Alias
Collagen Type XVII Alpha 1 Chain BP180 BPAG2 180 KDa Bullous Pemphigoid Antigen 2 Collagen, Type XVII, Alpha 1 Collagen Alpha-1(XVII) Chain BA16H23.2 (Collagen, Type XVII, Alpha 1 (BP180)) Bullous Pemphigoid Antigen 2 (180kD) Collagen XVII, Alpha-1 Polypeptide Bullous Pemphigoid Antigen 2 Alpha 1 Type XVII Collagen Type XVII Collagen Alpha-1 BA16H23.2 BPA-2 LAD-1 ERED JEB4
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000494.4
Sequence length
5612.0 nt
GC content
0.5609

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2242.10 kcal/mol
Thermodynamic ensemble
Free energy: -2330.07 kcal/mol
Frequency: 0.0000
Diversity: 1381.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.....(((((((((((............))))))))...))).....)))))))....(((....(((((...)))))....)))....((((((((((((((((((((..(((...((((((((..((((((.....((((...(((((((((..(((((.((((((((...................(((.((((...(((.(((........))).)))..))))..)))......)))))))).)))))......((((((.(((((..(((((..(((.....)))((((((....))))))))))))))))........((((((......(((((.((.((............(((((((.(.....(((((...)))))..).))))))).((((.(((....))).))))...)).)))))))........))))))...((((...))))..(((....))).)))))).(((((.....(((((((((.((.((((....((((((.(((.((((.((..(((.......((((((......)))))).(.((((.(((.((((.........)))).))).)))).).((((((((...((((...(((((.......)))))..))))....))))..))))..(((((((.....(((........)))......(((.....))).....))))))).))))).))...)).))).))))))......)))).)).).)))))))).((.(((((...))))).)).)))))....(((((((((((.....((.((((.....((((....))))..((((((.((((((((((((((((((((..........((((..(((((.(((((.(((((.........................))))).)).))).)).)))........))))(..(((((((((((((((((((((((.(((.((.((((..(((((((.(((((((((((.((((....))))(((.((((((((.(((((.(.(((..((.(((((((((((((..((((((...((((((............))))))..........)))))).....(((((..........))))).(((((((....).))))))(((((((.((((......))))...(((.(((((...((((......((.........)).......))))...)))))))).............((.(((.((((.(((.......))))))))))))..)))))))((...((((((((.((........))..))))))))..))..((((((......((((..(((((((((..(((....)))..))).).)))))......(((((.....)))))......................))))...))))))))))))))))))).))..))).).)))))))).))))).)))(((((((..(((((...))).))..)))))))...))))).(((((((....))))))).....(((.(((((.((((((...........)))))).))))))))((((((((.....))))))))..((....))(((((((.((((((.((((....(((.(((((((((((((.....((...((((((((...(((((((.((((((..((((((((((....((...((.(.(.((((((((...((..((.((((((((((..(.(((((........((((((.(((((((.(((.......((((((((.((.(((.(((......(((..((((((..((((....((((....)))).......))))........(((((((.((........(((((..((((.(.((.((((...(((((....)))))...)))).))))))))))))((((.(((((....)))))...))))......(((...(((((....(((((.(((((((((((..((((((.....((((......))))...(((((((.((((...((((((((((...(.((((((((.....((((.....((((((.(((((..(((.((.((....)).)).((((((...(((((..(((.(((((((..(((((((...((((.(((((....((((((((.....)))))))).((((((((((((.(((..((((.((((((((((((((((((((....)))).....(((..((((.((....)).))))..))).))))))..........(((((..(((((..(((((((((((........))))))))))).......(((((...(((((((((.((((.(....).))))..))))))...))).))))))))))...))))).....)))))))))).....((((((...))).))).)))).))))))).))))))))))))).)))).(((((....)))))...)))))))..)))))..)))))....)))))...)))))).......)))..))))).)))))).((((...((((((((((...))))))).)))))))....(((((((((...(((((....))))).))).)))))))))).....)))))))).)...))))))))))((((.....))))....(((((........)))))....)))).)))))))...))))))...(((((....)))))....))))))))))).))))))))))..((((((.((((...(((..((((((.((((((.((((.....))))...(((((....))))).............(((((((((..((((.....((...((((((....)))))).))..(((.(((....))).))).))))..)))))).....))).).))))).)))))).))).......)))).))))))(((((....)))))...((((((((((((((.(((....((.((((((..(((((((...(((.((....)).)))..)).))))).))))))...))....))).)))))))..)))))))(((.....((.((((...)))).)).....)))))).((((((...))))))..(((((((..(((((((....(.((((((((..((((((((..((.((.((.(((((........))))))))).))....)))))..)))..))))))))))))).)))..)))))))(((((....))))).))))))))).))))))..)))....))).))).)).)))))))).....(((((((((((((...)))))((((((.((((((.(.(((((((((((((.((....(((...(((((((.(((..(((.(((((...))))).)))(((((((.((....)).)))))))..(((((..(((((((((((((((....(((..((((((((....(((((..(((.....)))(((((.(((((..(((((((((((..........))))))).).)))..))))).)))))......((((.((((((((..(((((((((((((.((..((.((((..(((((...)))))......)))).)).)).))))((((....)))))))......(((((....)))))))))))...)))))))).))))((((.((((((((((..(((....)))..))))).............))))).))))((((((..........)))))))))))....)))))))))))...))))))))))))))).)))))))))))))))...))).......((..((((....))))..)).....))))))))))))).)).)))))))..)))))).)))))).)).)))))))))))))))).)))))).)))))..))))).))..)))))))))).).)))...)))))))))....))).)))).))...)))))))..))))))))))...))))))))))).)).)))...)))))))).)).)))))))..))))))..)))))))..)))).)).)))..))))))))..)))).....)))))....))))))..)..))))))))))))..........((((((((.(((((((((((((............(((((((((.(((((.((((((....))))))((((..((((((((((......((.....))...((..((((.(((.(.((.((.......)))).).))).))))..))((..(((.((((((.....((((((((((.....)))...))))))).....))))))))).))..))))))))))..)))).....)))))))))).))))...)))))))).))))).)).......))).))).....)))))))).))))))....)))).))..)))).))))))).(((..((((((.(((((((....))))).))..)))))).)))))))))))).....)))).....)))))).....))))))))...)))((((((((((.(((((.(.(((((((((.........((((((..((((((.......))))))..)))))).((((((((((((.(((((.....))))).)))).))))).)))))))).((((((((...((.((((((((...(((((....).))))..)))).....((((.(((((.....((((((.(.(((((...((((....))))...))))).).)))))).....((((((((((((.(.(((((....)))))...).))).....)))))))))..((((......))))))))).)))).......((((((...(((((..(((.(((((.((((((((((.(((((.((.((((......(((((...((((((((.....((((...........)))).((((((((((((((.((((.((((((((...((((((((((((.(..((((......))))..)))))))..))).)))..))))).))).)))).))))))...)))..)))))..((((.(((((....)))))))))..)))))))))))))................((((((((......)))))))))))).)).))))).((((....((((.....))))..))))((((((.....(((((....(((.(((((((((((((.(((.(......).))).))))))).)))))))))...)))))..))))))...........)))))).))))..))))))))..)))))...))))))...(((............)))(((((((......))))))).)))).))...))))))))..)))).).)))))...)))).))))))((((((((......))))))))..(((((.....(((((......))))).....))))).....((((((....))))))........)))))))))..........)))))))))))....
Thermodynamic Ensemble Prediction
..(((((((.....(((((((((((............))))))))...))).....)))))))....(((....(((((...)))))....))),{{{(((((((((({(((((((((..(((...((((((((..((((((.....((((...(((((((((..(((((.((((((((.................,.(((.((((...(((.(((.,....,.))).)))..))))..)))......)))))))).)))))......(((({(.(((....)))}}.})))......((((.((((((.((((((((...(.(((((.......(((........)))(((....)))..........(((((((.(.....(((((...)))))...,)))))))...((.((((((({.,{{.((((..((((((((,,{((((....(((((..((((((...{{..,,{....|||.,}{{{...))}..,|,{(((.(((((,(.{(..,.,,,,},|,))))).))))}|({{({{.......,,))))}}...))))))...)))))...(((......)))......))))).)...)))))))){{((((({({,,.{{|||,,.....}}})),}),,,...,||,,..))},..)))))},.}...)))).))))))))))..,),|,.....))))).}...)))))..))))))))).)))),{{(,((((,({,...,{{({{{{,|||,}}}}}}})}|{|||},,|||}|,,.{,,......,||{|||{||||.....{{.{{{{...,.{|||,..,)))),|((((({.{((((((((({((((({{{{.,,,........}},..,|{|,({(((,((({(,{,,.........,{,,..,,,,|.|||}}.}},))},)),)),,,........}}|,.(((((((((((((((((((((((.(((.((.((((..(((((((.(((((((({{,.((({....}}}}(((.((((({((.(((((.{.(((..((.(((((((((((((.,{{(((({,.((((((,........,..)))))}.{{{,{{{{((||{|{{,,..,{{{||,.,||,..||}}|{{(((((((....}.)))))),|||,,,.,,{|,,,,..,})),,,((,{(((((...((((......{{.........}).......))))...)))))))),{,...,,,....((.(((.(((,{(({,......)))))))))))),{||,,|||((...((((((((.{{........))..))))))))..)},.|||||{....,}}|}}..{{{{{{,,,..,(({,.{|||..|||{,.,|||,,{..{,(((((.....)))))...,||,,,||,|}}...}}}}.}))}.,))).)}))))))))))))).)),,))),).)))))))).))))).)))(({((((,,(((((..,||},||,,|}}}})),}}))|)),{((((((....))))))),.|||((,{(((((,{{{{||,,.},,.,,}}))}))),))})))}}{|||||||.....)))))))).,|{|,,,},(((((((.(((((,,((((....(((.(((((((((((((..{..{...,((((((((...(((((((.((((((..((((((((((....{,...((.{.{{({((((((...((..((,((((((((((,,{.(((((........{(((((,{{{{{{,.,{({{{{,{{{(((((((.,(.(((.(((,.....(((..((((((.{((((....,(({....}}}.,((..(((((((((({...,(({,({((({..{{||.(((((..{(((.(.((.((((...(((((....)))))...)))).))))))})))))((((.(((((....)))))...))))......{,,.,.(((((....(((((.(((((((((((..((((((...{.((((......)))),..(((((((.((((,..((((((((((...(,((((((((.....((((.....((((((.(((((..(((,((((({..{(({,..(((((,{(((((((((((({(((((((,..(((((({,.(((({((((,((({((((((((.....)))))))).{(((.((..(((.(((.,((({.,,{.,,|||||{{{{(((((....}))),..},)||..||||,|)}}).))})))...)).}))).)))).}}..,{{((((,,.,(((((.(((((((((((........))))))))))}{.(({.{(((((...(((((((((.((((.(....).))))..))))))...))).)))))})))}}..))))).....))))))).,,})}}.})))))}})),,,)))))),}))))))}..})),))))))))...)))}(((({....)))))...}))))))..{{{....)))}},...|||||....))))).......)))..))))).)))))).((({..,((((((((((...))))))).)))))))....(((((((((...(((((....))))).))).)))))))))).....)))))))).),..)))))))))),|||...,,||}}..,,||(((........}}))}....,}}).)))))))...))))))...(((((....)))))....))))))))))).)))))))))),.((((((.((((...{((..((((((,((((({.((((.....))))...(((((....))))).............{||{(((((..((((.....||,,.((((((....)))))).}}..(((.(((....))).))}.))))..)))))}.....}}},}.))}}}.)))))).))).......)))).)))))),{{{{....)))))|..((((((((((((((.(((.,.,{{.((((((..(((((((...(((.((....)).)))..)).))))).))))))..,))....))).)))))))..))))))),}),....,..{{{|,,,)))).)},.}}}|||}}}}))))}||}||||||,,.{((((((..(((((((....(.((((((((..((((((((..((.((.({.(((((........)))))}}}}.))....)))))..)))..)))))))))))))})),..)))))))|||||,,.,))})),))))).....))))))..)))....))),))).},.}))))))|{({..{{{{{{|{(|{{{|,.|}||}((((((.((((((.(.(((((((((((((,{(....(((...(((((({,((({,(((,(((((...))))),))}{((((((.{{....}).}}))))}..||{||..(((((((((((((((....(((..((((((((.,..(((((,,((({{{{,||{{{{{{,((((({{(((,(((((((.{......}.))))))).}.}}}..}}}||,||||||,|,..,(((,{{((((((..((((((((({((({({..{|}|||{.,((({,..{|||||.....})))),)}.)}})))}((((....)))))))......(((((....)))))))))))...)))))))),))))||{{.||||||||||||{....)},}))}||||}....}}},.....}}}}}.}})}((((((..........))))))})))),,..))))))))})),..))))))))))))))).)))))))))))))))...))),,.....||..((((....))))..)},....})))))))))))).)).)))))))..)))))).}},))).)},))})))))))))))}}.)))))},))))),,))))).)),.)))))))))).,.)))..})})))))))....))).)))).))...)))))))..)))))))))).,.))))))))))).)).)))...)))))))).)).)))))))..))))))..)))))))..)))).)).)))..))))))))..)))).....)))))....))))))..}.,||||||}}||||,.,{(,....((((((((,{{{{||{{{{||(|.,{,||,,...(((((((((.(((((.,,,,(({,,.,,,,,,((((..((((((((((,.,.,,{{.....},..,|,,.((((.(((.(.((,{{.......}))).).))).))))..,|((..(((.((((((.....((((((((((.....))),..})))))).....))))))))).))},))))))))))..))))))}..)))))))))).)))).,.}}}}}})).))))),||,......))),)))}},,.}))))))).))))))...,)))).)),})))}.)))))))}||,..||{(((.(((((((....))))).))..)))},)})))))))))))).....)))).....)))))}.....))))))))...)))((((((((((.(((((.(.(((((((((.........((((((..((((((.......))))))..)))))).((((((((((((.(((((.....))))).)))).)))))},))))))).((((((((..,((.(((,((((...(((({....}.))))..}))).....((((.(((((.....((((((.(.(((((...((((....))))...))))).).)))))).....(((((((((((,.{.{{{({,...}})},.,,,,,},.},..)))))))))..((((......))))))))).)))).{((...((((((...(((((,.(((.(((((.((((((((((.((({(,((,{{{,......{{{{(,,,((((((((...{.((({...........)))).((((({((((((((.((((.((((((((...((((((((((((.{..{{{{.,,...}}})..})))))}..))),}))..))))).))).)))).))))))...)))..)))))..{(((.(((((....))))))))},.))))))))}}}}}................((((((((......)))))))).,,,.}),))))),{(((....{(({.....)}))..)))}{(((((.....(((((.,,.(((.(((((((((((((.(((.(......).))).))))))).))))))))),,.)))))..)))))}...........)))))).))))..)))))))).,)))))...)))))).,,}||.............{((((((((......)))))))))))).})...))))))))..)))).).)))))...)))).)))))),{((((({...,,,))}}}}}|..(((((....,(((((......))))).}...))))).....|(((((,,..,,,))),.......)))))))))..........)))))))))))....

Transcripts

ID Sequence Length GC content
AACAUUUUUGAAAGAUCACUCAGCUUUAACACACCUUGGCUGGGUCUGG… 5612 nt 0.5609
Summary

This gene encodes the alpha chain of type XVII collagen. Unlike most collagens, collagen XVII is a transmembrane protein. Collagen XVII is a structural component of hemidesmosomes, multiprotein complexes at the dermal-epidermal basement membrane zone that mediate adhesion of keratinocytes to the underlying membrane. Mutations in this gene are associated with both generalized atrophic benign and junctional epidermolysis bullosa. Two homotrimeric forms of type XVII collagen exist. The full length form is the transmembrane protein. A soluble form, referred to as either ectodomain or LAD-1, is generated by proteolytic processing of the full length form. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.