Basic Information

Symbol
COL19A1
RNA class
mRNA
Alias
Collagen Type XIX Alpha 1 Chain Collagen, Type XIX, Alpha 1 Collagen Alpha-1(XIX) Chain Collagen XIX, Alpha-1 Polypeptide A1 Chain Of Type XIX Collagen Collagen Alpha 1 (Y) Chain Collagen Alpha-1(Y) Chain COL9A1L D6S228E
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001858.6
Sequence length
8740.0 nt
GC content
0.4104

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2548.90 kcal/mol
Thermodynamic ensemble
Free energy: -2719.92 kcal/mol
Frequency: 0.0000
Diversity: 2063.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((...((((((((.(((((.(.((((......)).))...).))))).))))))))....................(((((........)))))...(((((..((.(((...))).))..)))))((((..(((((.......)))))..)))).)))))))))......((((.((((...(((((((((..(((((((((((((.(.(((..((((((((((((((.....((((.(((((((..((((....((((((((....))))))))...(((.(((((.......))))).))).(((((((((.(((...(((...........)))..))).))))))))).(((((.(((.....))).)))))(((((((..((((((.(((((.((.(((((.((((.(((....(((((.........)))))((((...((((((....)))))).)))).(((((...((..((((....((((((......(((...)))......))))))..(((.(((((((......(((.(((.((((((..(((((((((......))))))))).............(((((((..(((((..((((((((.((.(...(((.(((((((..((((((((.((((......)))).....))))))))..)))).))).))).)))..))))))))...)))))..((((....))))))))))).(((....)))..((..(((......)))..))))))))...))))))))))))).)))........)))).))..)))))(((((((...........))))))).....))).)))).)))))))....))))).)))))))))))))((((.....(((((((....)))))))...)))).))))..)))))..)).))))...((((((((((((((((((((((....))))...((((((..((((((...((((((((..(((.(((((....)))))((.......)).....((((.((((.(((((.....))))).)))).)))).(..((((((.......))))))..)(((((((((((((((..((((((.((((.(((.((((((((((((((...............(((((....)))))((((((((((((((((((((((((((((..((((((((((...(((((......(((............))).......)))))...))))))(((((......))))).((.(((((.........))))).))(((....)))....((((((.(((((...((.((((......((((..(((..(....((((((...(((((....)))))...))))))....)..)))...((((((....)))))).............(((((.(((((..........((.((((((((((((((.....(((((((...((((..(((.(((.(((((.(((((((((((....))))))..................(((......(((((....)))))......))).......))))).))))))))..)))..)))).(((((....((((((.((((.((((((..(((((((((((((......))).)))))......))))).....)))))).))))......((((((((((((((((((..(...(.((((..(((((........)))))..)))).)...)..)))..............(((((.((((((.(((........))).))))))))))).)))))....(((.(((((..((((...))))..)))))))).((((((((..((.((..(((((.((((....((((((((((....)))))...)))))....)))).)))))..)).))..)))))))).(((........)))...((((((((((.((((((((((..((((.((((.(((((((.((((....)))).)......)))))).).)))...))))..))))))))))((((.(((((((((........)))))))))..))))...(((....)))(((((...)))))..((((((..((((...((((((((((((((((((.((...(((((.(((((..(((...)))..)))))..))...))).)).)))))))(((....)))...........)).)))))))))))).).)))))).......((((((.((((((..............)))))).))))))..((.((..(((((((((((((((((..((((((((((..((((((((((((((..((((((.(((((((.(((...(((..((.((((((...((((((..(((.(((((((((.(.(((((......))))).).))))((((..(((((......((....))...)))))...))))...((((((((..(.((((..((((...((.((((.(((((((...(((((..(((((((((((((((((........((((.((....)).))))............(((((.((.((....)).)).)).))).(((((....)))))(((((((((....(((((((((.((((((.(......))))).))...))))))))).......((.((.((((..(((....(((((((((....(((((((((((((((.(......).)))...........(((((((.((((.(((.(((...))).))).)))).)))))))......))))))))))).).....)))))))))..))).))))..)).)).))...)))))))...........))))))))))))))))).)))))...)).)))))..(((((((((.....(((.....((((..(.(((((.(((((((((((((((((........((((...))))..((......))..((((...))))......((((((...)))))).((..(((....)))..))....)))).))))))))))))).))))).)...)))).)))))))))))).)))).))...))))))))...)..)))))))).......................(((((((.(((...)))))))))).....))))).))).)))))).((((((((...((.(((((((....))))))).))...)))...)))))..(((((....))))).......(((((.(((((....))))).))))).))))))))..))).......................((((((((((((.(((((.(.((((((((.......)))))))).).))))).))))))))))))...))).))))))).)))))).......)))))).......((((((((((((((.(((..(((....((.(((.((.(((((.(((..((((((........))))))...))))))))...))))).).)....)))..))).))))...))).))))))).))))))))..........(((((.((.....)).)))))))))))))))..))))))))))))))))).....)).))......((((....))))...))))))))))((((((((((.(((.((((((....(((.(((....))).)))......))))..)).))).))))))))))....((((((((..(((((....))))).))..))))))..(((((((((((.((.(((((.((((........)))).)))...)).)))))))))))))......(((((((((((((((((...(((((((((....(((.((((((.........))))))...))).....((.(((((((...............((....(((...(((((.....)))))...)))....))((((((......((((((((..((((((((.....))))))..........................(((((((..........)).)))))....................))..)))))))).....))))))..(((......)))((...))))))))).))....)))))))))((((.(((.(((((((........))))))).))).))))...........(((((.((......(((((.(........).)))))...)).))))).))).))))).)))))))))............)))).)))))).))))))...)))))....((.((((((....)))))).)).........((((((((((...)))))))))))))))))))).))))...))))))))).((((((........))))))))))))))))....)))).....)))).)).))))).))))))....))))..))).(((((.........)))))...(((((((((((((((......)))).........((((((.((((.(((....((..((((.(((((((..(((..((((((((....((((((......)))))).......(((.((..(((((..((.(((..(((((((((...((((((((....(((.....))).........(((((........)))))....))).)))))..(((((((((..(((((.(((((.(((..((((((...(((((.....)))))((((((((....(((((((......((((.(.((((((((((((.(((.((((((...((((((((....))))).)))...)))))).))).)))....(((((((....)))).))).....)))))))))).))))...((((....(((.(((((....))))).)))(((((....)))))....((((((.((((......)))))))))).))))..))))))).......))))))))...((((.((((((((....((((((.((((((.......(((((((((((......))))).....)))))).(((((..((((((((((((((((.(((((((.....)))))))..))))))...((((.(((......))).))))(((((((........)))))))......)))))))))).)))))....))))))...))))))...)))))))).))))..((((.....))))))))))))))))))))))))))))))))))))))))).))).))..)))))....)).)))(((((.........))))).((((((......(((..(((((......))))).))).....))))))....((((((((((..((((...))))..)))))))))).....)))))))).....)))..))))))).))))....))......))).)))))))))).((((((((............))).)))))))))))))))))))))..)))))))))))).)))))..)))))))))))))))))))).))))..(((..((((....))))..))))).))))..)))))))).)))))))...)))..))))))))..))))))))))))..))))))))))))...)))))).(((((..(((.(((((((.........))))))).)))..))))))).)))))))))).))..))).).)))).)))))))....))..)))).(((((((((....)))))))))((((((((((((((.(((((((.((((......)))).))))..))).))))))..))))))))((((((((((((.....(((((...(((...((((((((((((..(((((...))))).....((((.((((........)))).))))................(((((((((.((((((((((.....))))).)))))(((((((((((((....(((((......))))).(((((.((((((......((((.........)))).....)))))).))))).(((((((((((.((.((((......))))..)).)).)))))))))...((((((....((((............))))....)))))).....)))))))))))))))))..)))))...((..((((((((((....((((((((.......(((..((((.......(((((........))))).......)))))))......)))))))).((((.(((((((......))))))).))))...(((.((.(((.......((((..(((((.......)))))..))))((((((((...................((((.....)))).......((((..((.......))..))))(((((...((((.......))))....)))))(((((((......)))))))...((((((.......))))))))))))))(((((...)))))(((((((((..((((((.((...)).)))))).))))).))))...))).)))))))))))))))..)).....................((((((.........)))))))))))))))))).....)))....)))))...))))))))))))..(((..(((((((((.((((((............))))))...)))))))))..)))((((((((.((((..((.(((..((((....))))))).))..)))).)))..))))).((((((......((((.(((((.(((((..((......)))))))......((((((((.....(((..((.((..((((((.......)))))).)).))..))).(((((((((.....)))))))))))))))))....(((((((.(((((((((((((((.......(((.(((((..((((.((((((((.......((....))...........((((((((((..((((((((.((((((...........))))))......(((((((..((((.(((....)))))))...)))))))..............((((..((((........)))))))).)))))))).))))))))))((((((((.((.....((((((.(((((((...(((((((..........(((((.((((((..........((((((((.(((...(((.......((((((((((((((.(((((((......((((((.((((((((........(((...((((((.........))))))...)))((((((((((....((((((((.((((((....((...((((((...))))))....))....)))))).)))...........)))))...)))))))))).(((((((.(((((.................))))).))))))).(((((.((((.((((..(((.((.((((....))))))))))))).)))).))))).)))))...)))))))))..))))))).))))))....)))))))))))..)))))))))))........)))))))))))..(((((((((.(.(((((......(((((.....((((((.((((.((.....(((.((..(((((((((.((.((((((...((((((((((((((((((((.(((..((((((((((...........)))))))))).....)))......)))))))).......((((((....(((((((((((..(((((((.((((((((((((......)))))))))..))).))))))).........(((.(((((((((..(((((...)))))..))))))))).))).....(((((.......))))).....((((((...............))))))....(((((((....)))))))..........)))))))))))(((....))).(((((((((((..................))))))))))).....((((.(((((.........)))))..))))...........)))))).......))))))))...)))).....)))))))).)))))))))..)).)))...(((.....))).)).)))).)))))))))))......))))).)))))))))))))))))))))))).((((((.........))))))(((((((....((((.((...)).))))...))))))))))))).....)).)).))))))...((((((((.....((((((.(((...))).)))))).(((((((((((((((........)))))..))))))))))...)))))))).(((((((((((......((((((....)))))).......(((........))).......(((((..................)))))................)))))))))))....)))))))).))))..))))).))).......)))).)))))....)).)))).)))))))......(((.((((((((....)))))))).))).))))).)))).......))))))...))))).)))).)))).
Thermodynamic Ensemble Prediction
....(((((((((...((((((((.(((((.(.(({(,.....)).)).,.,.))))).)))))))).........||,....,.(((((.(((({.......{{((((((((,.((.(((...))).)),.)))))))}})}.})))).))))).}......}},.)))))))))......((((.((((.,.(((((.((.(((......))).))))))}.,((((({,(((,((((({...((((,{((({(({{{{,,...,((((((((....)))))))},|.,,{.(((((,,.....|||||,|||.(((((((((.({{,.,{((.,.....,|||}},..|||,|||||}}}).||||{.|||}},..}},.,,,||((((({{,,{(((((.((((({((.(((((|((({,(((|,.,(((((,....,...}||||((((...{((({(,,.,}}}}}|,|}||,(((({...|||,{{{{,...{(((((..,,,.(({...}))..,,,.)))))}..{((,(((((((......{{{{{{,.((((((..(((((((((......}))))))))......{{{.,{{(((((((..(((((..((((((((.((.{...(((.(((((((..((((((((.((((......}))}.....))))))))..}))),,)).))).}))..))))))))...))))}..((((....))))))))))}.,|},.}}}|,..((..(((......)))..))))))))...}))))}))))))}.)))....,}}})))|}}}}},,|}}||,{{(({{..{,,{{,.|||||||.,,,|}}|,|}}}.}))}}||.|||)}))}.)))))))))))))}|,,.....(((((((....)))))))...||,..|||},,})}}.,{||{..,,...|||||(((((((((((((((((....))))...{(((({,{{(((((...((((((((,,{((.(((((.,,.|||}}||.......,,.....{{{{.{(({.{{{{{.....})))).)))},))))....{(((((.......)))))}{{{(((((({((((((((..((({{{,((((.((({((((((((((((({.........,,....(((((....)))))||{(((((((((((((((((((((((((..((((((((((...,(((,.{{(..(((....}}.,...})),.}}}..}))))){{{|||,,,(((((......)))))..|}|||||......,,,|}}},.)}|{{.,,,)),....{{((((.(((((...((.((((..,...((((..(((..{....((((((...(((((....)))))...))))))....}..)))...((((((....)))))).............((((,,(((((,.........,(,((((((((((((((.,,..((((((..((((((....(((((.(((((.(((((((((((....))))))............))))).)))))....(((((....})))).....,{({.((((((,,(((...(((.{(({.{(,.((..(((..((((((((((..((((.((((((..(((((((((((((......)))})))))......))))).....)))))).))))((((.((({.{(,...)).,}.}}})))).....(((,{((((......,.))))))))|((((...(({.((((((((((((({..(((((.((((((.(((........))).))))))))))){((,(({,..(((.(((((..((((...))))..)))))))).((((((((..((.((..(((((.((((....((((((((((....))))),..,))))....)))).)))))..)).))..)))))))).{((,.,....,)))...((((((((((.((((((((((..((((.((((.((((((,.((((....)))).}......)))))).).)))...))))..)))))))))}((((.(((((((((........)))))))))..)))).,.(((...,|},(((((...}))))..((((((..{(((...((((((((((((((((((.((...(((((.(((((..(((...)))..)))))..))...))).)).)))))))(((....)))...........}),}))))))))))).,.)))))).......((((((.((((((..............)))))).))))))..{{.{{..(((((((((((((((((..((((((((((,.((((((,((((,...(((((((.((.((((((.{,{{(((.......)))))}..(((((.(((((...((((((((.((({(,.,,..}}))},|,|||.((((..{((({....{{((....|)|},))))}...))))...,))|,....{{{|..,...{|.,}}|{{(((...)))))}.))))))))...))))).})))).,,............,.(({{..{{{.{({.........,,...}}}.)))..))}))))))).)})))))))...)))),)}))))){(((....,|||...|||||||...{(((((((((((((((({.(((((((((((((....{{(,.((({({((({{..{((((((((...,(((((((((((((((.(,,,,..|,|||,{,{{.,,...{((((((.((((.(((,(((...}}}.|)|,}))}.|))}))|......}})))))))}}.}.....)))))))))||}||.,.})).))}},.||,,.||||||...............,....||((|((((({...)))))).)))},.,((((((((.....((((,,...||,,..,.(((((.(((((((((((((((((.,.,,{{{(({{...||},.,{(,.....)).,((((,..|}}}.,....||||||...}|||||.((..(((....)))..)),})})))).))))))))))))).))))).))}}))))})))),)))}))),}})))))},)))),((|,..}}.{|{{{.,,,...,}}}}...............(({((({{(((...)))))))))}..,.,((((((,.|,|.||}},|||{((((...((.(((((((....))))))).))...)))}..})))},.(((((,.,.)}}}}....,,{(((({(((((((.,,((|((.{|.|||||..||||.|||{...{{({.(,..,(((({,....(({,,,((((({.,(((....)))}|,,,||}|||}}}}))),},,)))}}}}}|}))),..,))}}}.)}.)).)))).)))))))((((.(((|({....)).))).)))).......}}}))},..,.,}))}})),)))),|||,||,..((((((......,.))))))....},,})))))))..}}}..))),,,))))))))))...))))))}}))))).))))))))}.....,,,.,((((.((.....)).)))))))))))))))..))))))))))))))))).....)).)),.....,,||..,,))))...))))))))))((((((((((.(((.((((((....(((.{(,....})).)))......)))),,)).}}}.)))))))))){{,.{{(((({{..(((((....))))).)}..))))))}}((((((((((({((.{{(((.,(((,.......)))).)))...)).}))))))))))))...((((..(((.((....}).))).))))}})))))..(({.((((((.........))))))...)))})))))))((((((((................))))))))..(((((.....))))).)))))).})).))))|,,,,,.,{{.}}}))}))))))))))..)))..)).}},)))}.)))))).}.)))))),,.,},..((((((...(((((..{{({({..(((({{{{....,,,{{{,...........,,.((((....)))).}}....(((.{......}.))),}}}}}},....,..||||}|||.,||||||....,{{{,,,,||{{|||.,,||{{{{.......,{{||,{{|,....{{,{|.|,,,.....|{|||,,...))))),))}))).}))))))))}}}......)))))...)))))))))))..)))))).)))))).....{{.((((((....)))))).}}...,((((.((((((((((...))))))))))..,)))})),.))))...)))))))})}{(((((........))))))))))))))))....))))..}..)))).)).))))).))))}}....))))..))).(((((.........)))))...(((((((((((((((......)))).,,.((((.((((((.((((.(((..,,{{..,(((.(((((((..(((..((((((((....((((((......)))))).{{{{{.(((,((..(((((..((.(((..(((((((((...((((((((....(((.....))).........(((((........)))))....))).)))))..(((((((({.{(((((.(((((.(((..((((((...(((((.....)))))((((((((.,..((((((({{....((((,(.((((((((((((.(((.((((((...(((,((((....))))}.)))...)))))).))).)))....(((((((....)))).))).....))))))))),,))))...}},{,,{{(((.(((((....))))).))),||,,.,,..|||||.,.((((({{((((......)))))))))).}}}},.})))))).,.....))))))))...((((.((((((((....((((((,(({{{{..|,,,.(((((.(((((......))))).||,,},}))}.|||||.,{{{{{,((({{(((((.(((((((.....)))))))..)))))))},((((.(((......))).))))(((((((........))))))).....,|||||,||||.,,))),.,,))))))...))))))...)))))))}.))))..,,{,.....}}},))))))))))))))))))))))))))))))))))))).))).))..)))))....}}.)))|||||,,,......}}}}}.((((((.{,,..,,{,}||{{|......}}}}},}}}...,.)))))}....((((((((((..(((,...,)))..)))))))}))...,.)))))))).....)))..))))))).)))),...},..,,..))).)))))))))}.}}}}.||,,,.,,.,,,.....}.,,,,,)))))))))))})))),.}))))))))))).)))))..,}}))))))))))))))))).)))).,|,,..{{((,,..,,,}..}}},,.}})}..)))))))).}))))},.,})))..))))))))..))))))))))))..))))))))))))}.,,,}}}|{((((({{{{{.(((((((.........))))))).}}}..,,}}}.,,,,||,......,},,},}}},,|{((((((........))),}))}|((((((((....))))))))}((((((({((((((.{({((({.((((......)))).})})},},,.))))))..})))))))((((((((((((.,{..(((((.{.(((...((((((((((((..(((({...})))).....((({.((((.,....,.)))}.}))}.......,,..,,...((((({(((,(((((((({(,....))))),}))))|((((((((((((....{{{{{......})}}}.{((((.((((((......((({.........)))}.....)))))).))))).(((((((((((.((.((((......))))..)).)).)))))))))...((((((.,..((({............}}}}....)))))).....))))))))))))})))}..)))))...{{..((((((((((....((((((((.......,{,..{(({....{{{(((((,.......,)))),.}))}}}}})},}......)))))))).((((.(((((((......))))))).)))),{{({(.,{.{{{.,,,|,,((((,.((({{.......,,,,,..||||(({{(({{......,......,.....|||{|,.,,}}}|,,,,.}}||||,,({|......,}.,},,,,,,,,...,{{{.......,|||,...|||||{{{{,||},,,..})))},,.,{((((((.......))))))))}})}}|{((((...}}}}|{,...{{{(,,((((((,{{...}}.}))))),)))))))))}...))),))))}))))))))))..}}.....,,..............((((((.,.......)))))))))))))))))).....)))....)))))..}))))))))))))..{{{,.(((((((((.((((((............))))))...)))))))))..}},........,,))))))))|....,{{{,,,,)))}|||{||(((((((({{,{||,,,,))}}.})))))}))))))||||.,{,,,..||,,..,,})))),)}}}}}.{{(({{((,,...{({..|{.{{..{{{{((.......}))))),)).},..})}.{((((((((.....))))))))}}}}))))},,,.(((((((.(((({{(((((((,,...)}}}}}|.(((((..((((.((((((({....,,.{(....}},|,........((((((((((..((((((({.((((((...........}}}}}|......(((((((.{((((.(((....))))))},}.)))))))|,...,,..,,...|{{|,}{|||..,,,,..}}}}))},.}))))))).))))))))))((((((,,.{(.{{{{((((((.(((((({..,(((((((,{....,},.(((((.{{{{,,....,,,,.,({{{{{{{.|||.,,(({.......((((((((((((((.(((((({......(((((,,((((((({.................|||...,,{.....))}.{{{{({((((((((((....((((({,(,,(((((,...{,...{{{{({...,|}}||.......,,.}}}}}}.))),,,.,}.....)))))...)))))))))}.,,,.,{{,{,,,,.............,,}})))),.,}}}},..(((((.((({.{(((..(((.(,{((((....))))))))).})),)))).))))).}))))...)))))))))..})))))).))))),...}))))))))}}}..}}}))))}|||{{{....})))))})))))..(((((((((.{.(((((..,.,.{(({{..,.,{{{{{(,({{{.{{.....(((.((..(((((((((.((.((((((...((((((((((({((((((((.,,{({({{(((((((..{,,......,))))))))),},,.)))......)))))))),,,,,,,({{{((,..,((((((((((({.(((((((.{({(((((((({......}))))))))..}}}.))))))).}},,.{{.{((.(((((((((..(((((...)))))..))))))))).)))....,{((((.......))))}.....{(((((..{{......}}.,.))))))....{,,{((({{{{,,,|},,......,}}})))))))))))|,,....|||.(((((((((((............,.....)))))))))))..,,,(({{.{{|||,........)}))),,)))}.,,....|}}.,}}))}.......})))))))...)))).....)))))))).)))))))))..)).))),..(((.....))}.}}.}}},.}))))})))))......))))}.))))))))))))))))))))))))}||{{{{.........}})}}}(((((((.,,.((({.(,...}},))))...))))))))))))).,}}})},}}.))))))...((((((({.....((((((.(((...))).)))))).(((((((((((((((........)))))..))))))))))...}))))))).(((((((((({......((((((....)))))).......(((.{......)})},.....(((((..................))))).......,,.......)))))))))))....)))))))).))))..)))))..........{||,,..))),,...)).)))).))))))),},...{{{.((((((((....)))))))).))),.,)))))))))......,((|....,))}},.)))).)))).

Transcripts

ID Sequence Length GC content
ACUCGCAGGGAGCUCACUCCUCGGCGGUGCCGCAGCCCUGUCCGGACUC… 8740 nt 0.4104
Summary

This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the COL19A1 was overexpressed in the ventral midbrain of a selectively bred line with low risk for voluntary methamphetamine intake compared to a high-risk line, as part of a broader pattern of extracellular matrix gene expression differences associated with innate addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].