Basic Information

Symbol
COL1A2
RNA class
mRNA
Alias
Collagen Type I Alpha 2 Chain Collagen Of Skin, Tendon And Bone, Alpha-2 Chain Collagen I, Alpha-2 Polypeptide Collagen, Type I, Alpha 2 Collagen Alpha-2(I) Chain Alpha-2 Type I Collagen Alpha 2(I)-Collagen Type I Procollagen OI4 Epididymis Secretory Sperm Binding Protein Osteogenesis Imperfecta Type IV Alpha 2 Type I Procollagen Alpha-2 Collagen Type I Collagen Type I Alpha 2 Alpha 2(I) Procollagen EDSARTH2 EDSCV
Location (GRCh38)
7:94394820-94431227
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Sudden cardiac death diagnosis Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000089.4
Sequence length
5072.0 nt
GC content
0.5453

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1931.70 kcal/mol
Thermodynamic ensemble
Free energy: -2022.54 kcal/mol
Frequency: 0.0000
Diversity: 1508.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((.(((((((....(((..(((((..(((....))).)))))....)))((((((((((((((..((((((((((((.((((.(((((.((((((.(((((((.....(((((((((.....)))))))))....)))))))....))))))...((((((((...(((.........))).)))))))).(((....((((((.........))))))....)))...(((((.....((((((((.(((((....((((((.....))))))(((((.((.(...(((..........)))...).)))))))))))).))))))))))))).))))))))))))))))...(((((..((.(((...((.(....((((((((((((((((((((.((((.(((((((..(((...))).)))))))..)))).)))..((..(.((((((((...((((((....))))))...))...)))))).)..)).)))))....))))).((.(((((((((((((((((.(((((((((.((.(((..(((((......)))))((((.....))))....))).)).)).)))).))))))))))))).))))))).))((....))...)))))))...).)))))))..)))))((((((((((.(((..(((.(((...............))).))))))))))))))))...))))).))))))))..(((((.............)))))(((..((((((((....))).))))).)))....)).)))).....((((.((((((((((..((((.....((((...(((((...(((.((.((((((((.(((..(((((((((((((.((..(((((((((.((.(((((((((..((((.((((........)))).))))..))))..((.((.((....)).)).)).(((((.((.(((.....((((((...)))))).....))).))..))))).))))).)).)))))))....((((((.((.((.((((.(((((((((.((...(((.((.(..((((((...))))))..))).))).)).))))))))).)))))).)).)).)))).....((((((((.(((((((((((..(((((.(.(((.((((.(((..((((...))))..)))))..)).))).).)(((((((...))))))).)))))))))).))))).))))))))......))..))..)))))).))))))).))).)))))))).))))).(((((((..(((........)))..)))))))..........)))))....))))..)))).)))))).)))).))))))))))).).))))))))))........(((.(((((.(((.(((....(((((((((..(((((.((.((((((((.((......((((((....)))))))).)))))))).))......)))))..(((((.((((((((.((((((((((.....))).....))))))))))((((.....))))..((((((....(((((((.(((((((.(((((..((((..(((((...(((((((((((((((..((((((.......((((....))))))))))..))))))))....))))).))...)))))....)))).))))).))).))))(((.(((((.....))))).))).(((((((((((.(((((..((((((....((.((((..(((((((((((.((((....((((((.((.((.((.((............(((((((((..(((.((........)).)))..))).)))))))).)).)).))..))))))...)))).)))((((..(.((.((((...)))).)))..))))......)))))))))))).))....))))))...(((((.((((...(((((((....(((((((((((.((((.((((((..(((((((.((....)).)).)))))...)))....((((((.(((..(((((((..((((((((((((.((((..(((.....)))..)))).....(.((((((((..((..((((..((((((.(((.((((((((((((((((...)))))).......((.((..(((..(((((((((((((((.((((((((((((.((.((.(((..((((((.(.((.((((((...)))))).)).))))).))))).)).)).)).)))))))..(((((....))))).)))..)))).)))))).)))))..)))..)).))....))))))....((((((..(((....((((....))))...)))..))))))(.((((((((.((((((.((((((.((...(((((((.(((((...)))))....((.((.....(((((((.(((((...(((((((((..(((((...)))))..)))))))))..)))))(((....)))..((((..(((..(.((.((....)).)).)..)))..))))))))))).....)).)).)).))))).)).))))))))))...((((.((.((.....(((((((.(((...((.(((((((((((((((((((((...((((.((((((((.(((((((((.(((((....)))))((((((.(((...((....((.(((((((..(((.((.(((((........))).)))).)))..))))))).))....)).))).)))).))....)))))....)))).)))))))))))).)))))))((((((((..((((.....(((((((((...(((...((.((((((.((((..(((((((((.((((((..((((((.((....))..))))))..(((((((....(((........))).(((((.((((......((((((((((((((...(((((.......))))).((.((((..((((((((((((((((........(((((...)))))....(((.((.((....)).)).)))((.(((..(((.(((...))))))..))).))))).)))))))..(((.(((.(........).))).))).........))))))..)))).))............))))).))))..)))))..((((.((((.(((.....((((.((((.(((((((((((....(((.(.((((....((((..(((((.(((((((..((.(((((..(((....((((((....((((.((......)))))))))))))))..))))).)).)))......((((..(((((((.....)))))))..))))..((.((....)).))))))...)))))..)))).....)))).).))).....))))))))))).)))).))))..))).)))).)))))))).)))))...........(((((..((..((((....))))..))....))))).(((((..............)))))(((((........))))).(((....)))..)))..))))...)))))).))....))).))))))))......)))))).))...)))...))))).))))..))))))))).)))((((((((((.....))))).)))))..))))).))))))))).)).......))).)))).)))...)).))))))(((.....)))...)).)))))))).)...(((......))).)))).)))..))))))..))))))..)))))))).).............(((((.(.(((....))).).))).))...)))))))))).).)..)))))))....))).))))))...))).)))).)))))(((((((((((....((((.((((((....((((.(((((.(((.....))).))))).))).).....))).)))))))(((((((((((.((....)).)))))))))))......)))))))))))(((((((..............(((((.((........)).)))))................)))))))......................(((((.(((.....))).)))))..))))))...)))))))...)))))))))((..((.((((......))))..))..))...((((((((((((((((..((..(((........)))..))..).))))..)))))))))))......((((((((((((((.(((((((((((..........(((((((.((((.....(((.....(((((((((((..(((.((((((...)))))))))))))).)))))).....))).))))..))))))).........((((((.((((.((..((((.(((((.......(((((((((.......((((((((((...........................(((((((.(((((((((.(((....)))...))))((((((((.......))))))))..((((.......))))....((((((......))))))...)))))..))..))))).(((((...(((.......))))))))....)))))))))).......)))))))))((((.....)))).)))))))))..)))))).))))))..)))).)))))))..)).))))((((((.((.....(((......)))...)).))))))............)))))))).))))).)))))))))))..................(((((...))))).....)))))))....))))))......))))).)))))..))))))))).....))).)))))))))))..((((((((((........((((.....((((((..(((.(((.....))).)))....)))))).....)))).........))))))))))...(((((....)))))....
Thermodynamic Ensemble Prediction
((((((((((((.(((.(((..(((((..,(((((.(({.,,(({{,,(((({{,..,(((((..(((((((,,...((((((((((.(((({(((((.((((((.(((((((.....(((((((((.....)))))))))....)))))))....))))))...((((((((...(((.........))).)))))))).(((..{{((((({.,......))))))),...)))...(((((.....((((((((.(((((....((((((.....))))))(((((.((.{...(((.......,,.)))...).)))))))))))).))))))))))))).))))))))))))))))}{(((((..,.{{((....,,})}....)))))}{{.(((.((((((((((..{((((((..,((((((.((.(({.,(((((..(((.(.(((((,(({((((((((.((({.((((..((((.((((.{,{((.(((..((((..{{...((.{.(((.((((({(({((((((((((.{((((((((.((.(((,.(((((......)))))((((.....))))..,.))).)).)).)))).))})))))))))).))||(((.(((((.(((((....(((((((....{{(,{((,...})))..,|{(({.(((.,.{(|((({{(((((....((((.(((((((.(((((((..........({.,(((((.{..((..........))..).))))))))..)))))))))..))))))))){{{.{(.{.(|{(..,...)).))))),))}((((.(((((((({((((.((((((((({.(((((((((((((.((....)).)))}}.(((((....))))).((((((((((((((.((,.(((((,({{,|||{......((((({.{{{((((((((((.,,.(,.((,{{.({,(((,(((,{(({{.{{{((({{.,{,{((((.....|})},{{,|}},.((((.((....)).))))...,}))||},}}}||,|))}.})),)}})|.)))}..|))))))))))}||})))))}|||,{|||,(({{|(.{(((.,,,,..(((({({{.,,.((((((((,((((((((.(((((((((((,.,(((..{.(((,{{((.(((..((((...))))..)))))..,).})).)..(((((((...)))))))}))))))))))},)))).)))))))),..........(((.(((((..||||,|,.(((((.{((((((...((((((((,..{,.(((({{,{(({,,.,}}})}}})}},.})|||})))))))....))))))}.))))).})}|)))))))))))))))}},,,,.)),,}.)))))))).)).)))))}))}||,...}),},.))))).,)))))))))))))))).....,)))))))).}...))))).((((((((({....(((((((((.{,,((...{{{(((.(((,((((({,,,..|||,.{,,|}||,}||||{(((,..{{||,|{{{{.(((.{,.{,((((,.(({((({.(((((..((((,.(((((....{(((((,({((({,.{({(((({...{{(((((....)))},)))),..)))))))},}}.))))},}}...)))))....)))}.))))).))),)}||{{||||||(,,{{,}}}}|((((((...{....,...))))))}}}}))){{{((,,,.}}}||{({((((((...(({{{,..,,|)}))),}),|}}|..,}},.||,..||||||{{{..,}}.}}))),,})),,})}.}})))))))),))).))})).)))},.||||,..,,,,})}}}|||}|,.|{,|{||,,,}}}|{}|,.,)))),||....))).)))}})},))}}}},,,))..}.))))).))))....}.}))).))))).......)))).))))}))))))))))))))))))}}||,||..}})},)),)))))))..))))).))))).)))}}))))).)))}.,),..}}...))))..))).)))}))))))))....)))).}))).))).......)).)))..})).))))).).)))..)))))))),)))))))),...))))).}}))}..))))))).)))||((((((((.((.((....)).)).)).)))))}}))},...))))))))..))))),}.,)})))}).,)))}))))))))......))))).))).))).)))))..{{....,})))))))...((((({...(((((((..((((((..(((....((({....})))...)))..)))))).,(((({.(,{{{{..,)))).|,}||},..|{.{|..,,||,}}.},|||,(({.((((((((((((((....((((((..(((((.....)})))..))))))..((((((((((((,((((((....(((.(((((..(((..{.((.((....)).)).}..)))..))))).)))....)))))).).)).))))}.,))))((((((((..........{((((((((((((((.(((.,.((.(((((((((((((((((((((...((((.((((((((.(((((((((.(((((....))))){{((((,(({,..{,.{{,((.(((((({..(((,(({,((((......,,})).}}|).}))..})))))).}}.,)})).))).}))),},.,,.)))))....)))).)))))))))))).)))))))((((((((..((((.....(((((((((.{,(((.,,((.(((((({(({(..(((((((((.((((({..((((((.{(....}}..)))))),.(({{,((({,.{{{{{{{.{..|||.|{{|{{(({.,,|||,(({{{{((((((((.,,{{{((,,{{{{.,|||}.((.(({{..||{|{{|||{|,|||||,|,|,..(((((...))))),||.{((.((.((....}|.}}.}}}((.(((..{((.(((...}))))).,))).))}})}}}))))}..,,(,{{({,{{{.....,.,},.)))}}}}}....)))))),.}))).}}.,,,}},,....))))).))))},|}}}).,||||.|||,{({{{{..{(((({(,,,.)}))}}|,|||}}},,,{{({(({((((.((.,..||.||}|||||||..((.(((((..(((,,,.,|||||....({{{{((.....,)})}))}}))},)))..))))).)).}}}....,.((((..(((((((.....)))))))..)))),)}}}})}))...}))))},,{{|||||{.||||.{{{{{|||.|{|||{{..,|}|||||||,,.,|||{||||{|,,,,||||{||,}}})},,}}))}}}}}}}.,,..,|||||...))|}}..},}}|,,.,}},..,..}}}))}|||||..,}}}})}}}}})))|||||}}}}.}}}),))).}))})...},..}}}}.))))...)))))).))....))).))))))))}}....)))))).)),,.))).}.))))),})))..))))))))).))){(((((((((.....))))).)))))..))))).))))))))).)).}.....))).))))).........,,(,,({{{....,)))}.{{|,..((((.{({,{.{{{.....,)))..)).))))...}}}{(((.(((((...))))))))}..........(((({,,,..,}}|,,.,|,,.|{||...,,.....,))))}.))))))))))))))))))..)))))......))))))).)).}}|((((........))))}.....(((((((((((((((((,..,.....|(((.((((,{(((((((({.....{{{.(,(((((((((((.((....)).)))))))))))},,,....),))))))))))))).)),,,...,{{(((((((,.(((((({{({...{{{{(.......{((((.,,..(((({{.(({......(((((.(.....(((((.(((,...,))).)))))....,)))))......))))}...))))...}}.))))),.....}})))............{((((((((((((((,..,({{(,,........,},..,}}})}},.}},})))))))))}.{(({.(((((((({(((,,.(((((((((({..,..,,{,,{{{....,}|||}},..(((.....(((((((((({..(((.((((({...}))))))))})))).)))))).....))).,,,|..,,,||||,..,,,..,|{{{{{.{{{{.{,..,||..{||{{{{{,,..(((((((((..,....((((((((({...........................(((((,{.(((((.,,,.{,.....,,},..,|||({{(((((,,,.,,.}}}}}}}}..,|||,,,,,,,|)))|...((((((......))))))...}}}}}..||,.))))}.{{(({,|.|||...,}..})))))))....)))))))))),,.....))))))))),,,,,,,.,||||,||||||,,,.,)))))}.)))))),,||||,|||}|||,{|}.}|{(((((((.((..,,.{((......))),,.)).))))))))}...,,,,,,}})))))),))}),,,,,,,,,)}}}.}}}}},...........(((({...}))))...{((((.....)))))..,))))))}})})))))))))))...))))))).},}}}}))))))).{{{{.((((((((((,{......((((.....((((((..(((.(((.....))).)))....)))))).....))))......,,.))))))))))...}}}},}))))).......

Transcripts

ID Sequence Length GC content
NM_000089.4 NCBI
AGCACCACGGCAGCAGGAGGUUUCGGCUAAGUUGGAGGUACUGGCCACG… 5072 nt 0.5453
Summary

This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

Forensic Context

A study in mice demonstrated that Col1a2, a canonical fibroblast marker gene, was used for cell type identification in radiation-induced skin injury [Yu et al. DOI:10.1186/s40164-025-00596-w]. In human erectile dysfunction, the COL1A2 was expressed in fibroblasts and showed higher expression in ligand-receptor interactions, with its expression increasing along a pseudotime trajectory from smooth muscle cells to fibroblasts, suggesting a role in fibrosis [Fang et al. DOI:10.3389/fendo.2022.874915]. A study in a Chinese Han population demonstrated that an indel polymorphism in the 3′UTR of the COL1A2 gene is associated with sudden cardiac death (SCD) risk [Zhou et al. DOI:10.1016/J.Legalmed.2020.101736].