Basic Information

Symbol
COL27A1
RNA class
mRNA
Alias
Collagen Type XXVII Alpha 1 Chain KIAA1870 Collagen, Type XXVII, Alpha 1 Collagen Alpha-1(XXVII) Chain MGC11337 FLJ11895 Collagen Type XXVII Alpha 1 STLS
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_032888.4
Sequence length
7813.0 nt
GC content
0.6132

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3489.44 kcal/mol
Thermodynamic ensemble
Free energy: -3614.52 kcal/mol
Frequency: 0.0000
Diversity: 2091.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.((((((......((..((((((((((...))))).)))))..))(((((((((.....(((........)))...((((.((((((((..(((((((((((....)))........((((..(((((((((.((((((.((........)).)))))))))))))))..))))(((((((.((((((((.(((((....))))).....((((((.(((.((...))))).))))))..))))))))(((((......)))))))))))).((((.((((((.(((.((((((((.(...).)))))))).))))))))).))))...))))))))..))))))))))))..)))))))))........((((((.((((((.((.(((.(((((.((((........(((((((((...(((.((.(((((..(((((.((.(((.(((...(((((.(((((((((((((((...(((((((((((.....(((..((((((((.(((..((.(((((.((..((((..(((.........)))..))))((((((((...)))...))))).((..(((((((.(((((......(((((((((.(((((((((.((((((((.............((((((((((((((((((((.....(((((((((((((.((((......))))..))).))))...))))))))))))..(((((....((.....)).(((((((.((((((((..(((((((..(.....)..))))).((((.(((((...(((((((((((((.((.(((.....)))))(((((((.((((((.((((((((.((.(((((..........((((.(.((.....)).)))))))))).)).))))))))((((.(((.((((((.(((((....)))))))))))))).))))((((((.((..(((....)))(((((((((.(((..((.(((.((((((((....))))))..)).))).))....))).)))..(((((((...((((((((.((...........(((((.((.....)))))))...(((((..((......))..)))))((((...(((((........))))).))))(((((.........))))).))..)))))))).....)))))))..((((..((((((((((((((((((.(((..((((.....(((((((....(((((((..(.(((((....))))).)..)))))))....)))))))((((((((((((.....((((....((.(.((((((.......((((((.((.....))))))))((((((.......(((((.((.(..((((((..((((.....))))...((.((((.((((.((.((((.(((.((((((((((((((.((((..(((((((((((((((..(((.....(((......)))...)))..))....(((((....((((.(((((...(((((...................((((.((((((..((((((((((.(((((((......(.(((.(((((((((.....(((((((((.((((((........))))........((((((((.((.(((((...(.((((((((((((.(.....((((((((........(((((((.((((((((...(((.(((((..((((((((.((...((((((((((((((.(((((......(((((...........(((((.((.(((((..(...((((((((((((.....((((((((((((((((.(((((..........(((((((.............(((.((((....(((..((((((((((...))))))))))...))).....(((((((((((.(((........))).)))................(((((....((((((((((((((((....(((((((((..((((((.(((((.(((((....(((((....................((((.((((((..(((.((((((..((..(((((........)))))..))(((((((..(((.((......(((((((..(((((((..((((((..((..((((((.((((..((.((((..((....((((((((((...((((.(((((.((.(((((((.((((.....))))......((((((((....)).))))))........((((.(((((.((((((((((((((.((((.(((.((((.(((....)))))))))).))))...)))))....(((((..(((((.(((((((.((((((..(((((((((((..((((.(((...((((((.............)))))).))))))).)))...)))))))).)))))).).(((((..(((((((...((..((.....))..))))))))).)))))..(((((.(((((((.(((.((((((.(((...(((((.(...(..((((((..(((..(((....((((......(((((((.((((((.((((.((....))))))((((....(((((((((((((((.((((((.((((......)))).))))))((((((..........)))))).....((((((...))))))....)))))))))))).........)))..))))..)))))))))))))......)))).......(((...(((((((((((...(((((..((((........))))..)))))....)))))))))))...)))((((((...))))))..((((..(((((.(((((((((((..(((.....(.((((((((...(((....))))))))))).).....)))..)))))))))....)).)))))..)))).)))...)))....))))))..)...).)))))...))).)).)))).))).)))))))..)))))...((((((((..((....))..)))))))).)))))).)))))..)))))((((((((((...((((........((((((.((((((...(((((...))))))))))).))))))(((((.(.........).)))))))))....)))))).))))......((((.((((.(....).)))).))))))).)))))).)))))..)))).))).))).).)).)))))....)))).)))).)))))))).)))).))..)))).).))))).))..))))))..))))..)))..)))))))..)))))..)))))))....))))))...)).)..)))))).))))..))).))...)))))))))).))).))).)))))).))))))))))))...))))).))...)))))))))))))..)))))))...(((((.((((((.(((((...)))))...))).)))))))).(((((.(((((..(.((((..((((((((.(((((...))))).).))))))).)))).)...))))).)))))).))))))....((..((((.((.((.....)).)).))))..)).)))))...))..((((((.(((((((...)))))))...))))))..)))))))...)))))))(((.....)))))))))))))))...)..))))...).)).)))))...(((((((((......((((((....((((((...((..((.(((((((....((....)))))))))..))..))...))))))....)))))))))))))))))))).....)))))..).))))))..)))))))..(((((....)))))))..)))))).))..)))))....)))...)))))))).)))))))......((((((.(((.....))).))).)))((((((((.((((.......)))))).))).)))))))))))...).)))))..))))))))))))).))))))).)))..((((.......)))))).)))))))))))))))))).(((((....)))))((((((((((..((((.(((((..((((((.......))))))..((..(((.......))))).)))))))))..)))))).)))).......))))..))))))).)))))).((((..((....)).))))..(((((..((((.((((((...(.(((((((((((.((((.......))))))))))))))).)...))))))...))))..)))))...)))).....)))))).)))))))))...))))).....((((.((....)).)))).))))......)))))))))))))))).))....((((.((((...)))).))))..))))))..(((..((((((((.............))))))))..)))((((.((.((.(((((((.......))))))).)).)).))))......))))..)))))))))))...(((((....)))))((((...)))).(((..((((....)).))....))).....)))).))..))))...))))))..))))))((((...))))).)).)))))...))))))...))))))))).))))....))))))))))))....))))..))).)))((.((((((...))).)))))..)))))))))).))))...)..)))).))))))))))))))))).)).).))))))).(((((...))))).)))))))....))))))...))))).))))...(((((((.(((..(.(((...))).)..)))..)))))))...(((..((((((....))))))..))).))..))))))))...)))))))....))))).((((((...))))))))))))((((((((((((((.((((......(((((.(((.....))).)))))..)))).))))).)).))))))).))))))))(((((..(.(((....))).)...)))))(((((....)))))....)))))))).))))))))))))......(((((((((((...))..(((((((.(.((.((((.(((((..(.(((..(....)..))).)..))))).)))))).)))))))))))))))))))))))......)))))..)))))))...))(((((((((((.(((.((.......(((..(((((...)))))..)))(((((((....((((((((.((((..((((((...((((.(((.(((((.....((((..(((((((((((((((((..(((..(..(((.....................)))..)..)))..))))).((.((.((((((..(((..(((((..(((.((((.....)))).((((((((((((((((..(((((((((..((.(((((((..(((((...))))).))))..)))))..)))))).....))))))).)))))).))))))......))).)))))..)))..)))))).))))......((((((...)))))).......)))))))).))))..))))))))).)))..))))....)))))).)))).............))))))))...............(((.((((((((((..(((((.....))))).....((((((...........))))))...((..((.(((..((((((((((((((.(.(((((...((((((....((..(((.(((..((((......))))....))))))..)).....))))))))))).)...)))))))...)))).....)))..))).))..))....)))))))))).)))..))))))))).))).))))))....)))))(((.(.((((((((..(((((..((..(.((((......)))).)..)).)))))..))))))))).))).))))))).)).))).)))))))))))))))))))))).)))))))(((((((((....))))))))).)))).)).((((((((((((.......)))))((((.((((..(((((....(((((...)).)))....)))))..)))).))))..))).))))...((..(((((........)))))..))))...)))))...)))))))))))))...))))).)))))..))))))))).)))).))))).)))))...))))))....((((((....))))))....))))))((..((((((..(.(((((...))))).)..)))))).))..........))))))...)))))(((((((((.((((((((((.((((((....)))))).............(((((((((((......))))))))))).(((((((((.((((.(((((((.((((.(((((..((((((..(((..((((((((.....((((((((((((((........)).))))))((((((((....((...((....))...))...))))))))...((((.....(((((..(((((..((((((......(((.((((.(((((.....((......))......)))))..)))).)))..(((((((((......))))))))).......(((.((((((......))))))))).(((((...(((((((((((.....((((.......)))).....)))).)))))))...)))))........(((..........................................)))...(((((.((.(((((((((..(((((.(((((.(((..(((((.((((....(((.(((....))))))((((....))))((.((.((((......)))).)))))))).)))))..)))((((((((((...(((((((((((((.(((((((.((((((..((((....)))))))))).......(((((..(......)..))))).)))))))..(((((.((((((...(((....)))....))))))...)))))....)))))..))))))))))))))))))((((((.((...(((((...))))).))..)))))).(((((((...((((((((((((((.(((..((((((((.(((....((((((....))))))(((.....)))..))).))))))))..))))))))))........)))))))((((((((((..((......((((.....))))....))..))))).)))))..(((((((.(((((...))))).))))))).........)))))))....))))))))))..))))))))).))..))))).((((((((........))))))))...))))))..)))))....)))))....))))...))))))............(((....)))...))))))..))..)))..))))))..)))))((((.((.(((.(.(((((........)))))).))).)).)))).....))))))))...(((((......))))))))..)))).))))))))).......)))))))................(((......))).......((((....))))))).)))))))))((((((((.((.((((((((....))))))))))))))....))))
Thermodynamic Ensemble Prediction
...{(((,((((((......((..((((((((((...))))).))))),,||(((((((({{..,.(((...,,...|||,,.((((.((((((((..(((((((((,......,|........,{{(..(((((((({{((((((.((........)).))))))))))))))),,||}|(((((((.((((((((.(((((....))))).....((((((.(((.((...})))).))))))..))))))))|||{{,,,,,,)))|||||||}}.((((.((((((.(((|((|((((({,..|}|)))|)))}.})))))))).)))),},))))))))..)))))))))))).,|}|}}}}}),.......((((((,({((((.({.(((.(((((.((((.,,,....(((((((((.,.({|.{(,(({{|..||(((.,|||((.{({||.(({||||||||((|(((((((...(((((((((({.....{{{.{((((((((.(({..{(.(((((.({..{(({..(((,......,.))},,}}}|{{{({((((((((({,.||(((,,,,.((((((({({(({{,....{{(((((((.{{((({({{.((((((({{{.{((,..{.({(,({(((((({{,(((({((((..{({({{((((.{{{,{(((({{{{({{..{{{{({{{(({..,,|))},|||,}}}),,)}))..))))).....{{{|{((,((((,(((({{,(({((..{.....,..}}})},{|||,|||||},}|{{{{{{(|{||,.,..{{|.|||||.}|,|((({{{|(|((((.(,((((((,,,{((({,{{{((.{...((((.({(({{{{.{|{{||{{|,||,{||{,,||||||{(((,(((.,,{{||.{((((....)))))))))||||,{||||(,((((.{({((((...{|,.((((((.(({((,((((,(({,,,((((((....))))))..),.))).},.,..|||.,}|..(((((((...((((((((.,({({........,(((({,{..}},)),.,,,...||||{..{{....|.}|..})))|(|((,..(({{{........)}))),})))||{{{,........}}}}),))..)))))))).....)))))))..|,,,}}},,{((((((((,((((({(,,..(((,.(({{(((((((....(((((((,{(.(((((....))))).,},)))))))....)))))))(((({,,((((({(...(((({...((...,{{{|{......,{{{,{{.(({..{{||||||||.(((.,.|}}....,|||}||}|}},,|||,..((((,.,,.}}|}...{{.,,{(.{{{{.,{,{{{(,(({.|{|||||||||{({.({{{..(((((((((((((((,.(((.....(((......))}...})),.}}....(((((....((((.((({{.,,(((({.,,...............,((((.((((((..((((((((((.(((((((......,.{{{.(((((((((.....{((((((((.((((((........))))........{(((((({,((.(((((...(.((((((((((((.(.....((((((((....{...(((((((.((((((((...(((.(((((..((((((((,((...((((((((((((((.(((((......(((((((((.....(((((((...{.((((..(...((((((((((((.....((((((((((((((((....))..........((((((.......{((((..{(((({,.....(((..((((((((((...))))))))))...))|{,.{{(((((((((((.(((........))).)))................(((((....((((((((((((((((....(((((((({..((((({.(((({,(((((....{((({.......,{,...{{{....{(({.((((((..(((.{(((((..{(..(((((........))})),.))(((((((..(((.{{...,,.(((((((..(((((((..((((((..((..((((((.((((..((.,(((((((({...((((((((.,..,((((((,{(((.......(((((,..(((((.((,.....((((((((....)).))))))...},,....}}.)))))..,,)))))(((((((((((.(((.((((.{((....))})))),))}))))((.(((((,,((((((((((((((.((.(((.,(((((.,{{{||||.(({||((({,.,||...{||,{(.{((({{|((|{{(((,,.,,,..}}},......(((((((((((((((((.(((((..(((((({...((..((.....))..))))))))).)))))(((((((((...((((((((((...(..(.....)..)...,))}...))))))))))).))))).((((........))))..(((((((,{,..(((((({(,.{,..(((..((..((((((((((((.((((({.((((......}})).|}})))((((((..........)))))).....{{{{{{,,,)))))),...))))))))))))))..)))....)..)),))))))...}.)))))))..)))))........(((...(((((((((((...(((((..((((.......,))}}..)))))....)))))))))))...)))((((((...)))))))))))).)))))).(((.(((((((..(((.....(.((((((((...,({...,)},)))))))).).....)))..)))))))))).,.,},)))))}))})}}}}...})))....,),))).)).)))))))))))))).,))))))).)))))))......)))))),,)))}.))).))))))))))))))|(((((.....)))))}((((((((((((((((,{...(((...)))...((.(((,.((((((((((((((((({{{,.((((.(((..((((.,....|.{(((((...(((((.......)}},})..))).}}}.,((((.((((.(...,).)))).)))))))).))).)))))}}..)))))))).))),.......})))))}}))}))))))))))))))))))))))..)))).),})))).))..))))))..))))}.}))..))))))).})))))..))))))).,,,}|}}}},,,)).}..)))))).)))))))}).))...)))))))))).})).))).)))))).))))))))))))...))))).))...)))))}))))))).}).)))}....(((((.((((((.(((((...)))))...))).))}))))).{((((.(((((,.(.((((..((((((((.(((((...))))).),})))))).)))).).,,))))).))))))))))))))}..((..((((.((.{(.....)).)).))))..))...,))))))...((((((.(((((((...)))))))...))))))..))))))}..,)))))))(((.....)))))))))))))))...)..)))).,})))))).|.(((((((...((((..((,((((((((.{((((({,.,(({.{,..{||}||,...|}.,..}})))))}).))))))))..)))))))...))))))),.)).)))))))).....)))))..),})))))..)))))))..{((((....)))))))..)))))).))..)))))....}))...)))))))).)))))))...|..((((((.{({,....)}}.))).))){{|(({{(.((((.,...,.)))))}.))).)))))))))))...).)))))..))))))))))))).))))))).))}..((((.......)))))).)))))))))))))))))).(((((....)))))(((((((({(..{{|{,{||||,}{(((((.......)))))}..,,..(((.......))))).}))))))}).,))}))),,)))},.....)),..,))))))).)))))).((((..((....)).))))..(((((..((((.((((((...(.(((((((((((.((((.......))))))))))))))).)...))))))...))))..)))))...)))).....)))))).))))))))).}}))))).....((((.((....)).)))).)))).....,))))}))))))))))).))....||||,(((({{,|,,,})))).,))}}.},.|||}}|,,,||||}}}..|,.}}...||}}||||..|||((,,.{|}||}{{,||||,,...{{|||,|,,.,,.),})))))))).}))))}})))))))))))...(((((.(((((|(|...))||},})).))))).,|,..})).))},..,).))}).)),,})...})))}}}},,)))}.)))))),|||}..)))),.,,}))),)}.}))))),..})))),))))}),))}}.,,}))))),})))}.,.,}))}}),).,))}|.,|}||}}},},),))}}}..})})})})))|})))|..}|.))))|)))))))}))))))))).)}.}|)))}})).|||||}.,)))))}}))))}).,,,))}))}.{{|{(({{,{|,...|,|}|||}}}{{.({(((...(((((..,((..((((((....,,,}}||||,|}...)))))...)))}))}.||}}}}},.,.||||||,,..|||{||||((((({..||||||||,|||||(((({.,{|||{,||||},}..,.|||{,|||,,,,,|||,|||}}..)))},))))}.,,.)))))|,,(((((|,{(((((,.,..,{.||,},.,)}).})))))||||||,||||||..,,}}|}}}}|.))}})))}}}}).,,,,,|||{{{{{{(({.,{{{.(((((((.(.{(.((((.(((((..,,({(,.{....},,})).,..))))).)))))).))))))))}))))})))}))))))))),)}}))}))))))))),,,}{|||{{||||||,|||,||.......(((..(((((...)))))..)))(((((((.,..((((((((.((((..((((((...((((.(((.(((({.....{{((..(((((((((((((({((,,{{({{({.({(.....................)))..,..}}|..}}}}).|{.,,.((((((..(((..(((((..(((.{(((.....)))}.((((((((((((((((..,(,((((((..((.(((((((..(((((...))))).)))),.,))))..)))))).....,,,)))).)))))).))))))......))).)))))..)))..)))))).,,||{.....{|||||,,.,))))},),..,.))))))))}}}))..))))}}})).)))..))))....)))))).)))).............)))))))),{,,...,{,,....|||.((((((((((..(((((.....)))))(({..((((((...........))))))...})).{,......||,{{{((((((((.{.(((((...((((((....{(,.(((,(((..(({({.....)))),,.,}))))},.)}.....)))))}))))).}...)))))))}.,|}}|{,{{{||,..,}}}})}.,..,,,)))))))))).|,}|,)))))))|}.}}}.))))))....))}))|||.{.((((((((..(((((..((..{.((((......)))).,..)).)))))..))))))))).))}.))))))).)}.))).)))))))})))))))))))))).)))))))(((((((((....))))))))).}}}}.))}||||{{{{({{{,|.....))))){{|{,({((..((({{.,,,({{{(.,,|||.}}....})))),.}}}}.))))..,,,....,...,{..(((((........))))).}))))..,))))),,.)))))))))))))...))))).))))),.))))))))),)))).))))),)))))...}})))|,.,.{(((((....))))))....)))))){||.((((({.,(,(((({...))))).),.)))))).}}.......,..))))))...}}}}|(((((((((.((({{(((((,{(((({.,..,,,,,}............,(((((((((((....,,)}))))))))}.(((((((((.((((.(((((((.((((.(((((..((((((.{(((..((((((((...,.,((({.((((({((,...{{{{(({,,,,,.((((((((....({.,,{{....}}...)}...))))))))...{.(((((((((........))))))))),,,....,{(.,((({{,(((,,...,.......})}}.|}}}|}}},||||,.,,,..(((((((((......))))))))),,,,.,.(((,((((((......))))))))}.{((((...(((((((((((....,((((.......}))).....)))),,))))))...})))}........,}}................}}}}},.,........................(((({.((.(((((((((..(((({{(((({.(((..(((((.((({..|,(((,({,....}))))){(((,.,,||}|{(,((.{(({.,...,)))).}))))))).)))))..)))((((((((((...(((((((((((((.(((((({.((((((..({{{....})},)))))).......(((((..(......)..))))).}))))))..(((((.((((((...(({....}))....))))))...)))))....))))).,))))))))))))))))))((((((..{...(((({...})))).,}..)))))).{{{{{{{...((((((((((((((.(((..((((((((.{((..,,((((((....))))))|{{.....)))..}}}.))))))))..))))))))))........)))))))((((((((((..((...,{,((((.....))))....))..)))))}}))))..(((((((.(((((...))))).))))))).........))))))),...))))))))))..))))))))).))..))))}.((((((((........)))))))).,||{,|}||,|,,,,...,,,,}},.,,......,)),..}.,}}}},.})).|{{,...,)),,,)))))),.))}}))))}))))))..)))))((((,...,|}}}}{({{{.{||.||{|(((||....,}}))})))))},))))))))...(((((......))))))))..)))).)))))))))....,,.))))))}..,.||||.,,|||,|,{{,,..,,))),.....,((((....))))))).)))))))))}{{{((((.((.((((((((....))))))))))))))....))),

Transcripts

ID Sequence Length GC content
CCUUUUCCUCUCCUCCCCCAGGCCGGCGGGGAGGCAGCUUCCACCGCCC… 7813 nt 0.6132
Summary

This gene encodes a member of the fibrillar collagen family, and plays a role during the calcification of cartilage and the transition of cartilage to bone. The encoded protein product is a preproprotein. It includes an N-terminal signal peptide, which is followed by an N-terminal propetide, mature peptide and a C-terminal propeptide. The N-terminal propeptide contains thrombospondin N-terminal-like and laminin G-like domains. The mature peptide is a major triple-helical region. The C-terminal propeptide, also known as COLFI domain, plays crucial roles in tissue growth and repair. Mutations in this gene cause Steel syndrome. Alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the COL27A1 was overexpressed in the ventral midbrain of a selectively bred line with low risk for voluntary methamphetamine intake compared to a high-risk line, as part of a broader pattern of extracellular matrix gene expression differences associated with innate addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].