Basic Information

Symbol
COL3A1
RNA class
mRNA
Alias
Collagen Type III Alpha 1 Chain Ehlers-Danlos Syndrome Type IV, Autosomal Dominant Collagen, Type III, Alpha 1 Collagen Alpha-1(III) Chain EDS4A Alpha-1 Type III Collagen Alpha1 (III) Collagen Collagen, Fetal EDSVASC PMGEDSV
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Time since deposition estimation

MANE select

Transcript ID
NM_000090.4
Sequence length
5490.0 nt
GC content
0.5220

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2127.20 kcal/mol
Thermodynamic ensemble
Free energy: -2220.80 kcal/mol
Frequency: 0.0000
Diversity: 1070.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((..(((....))).)))).((((((((((((((((......))))...((((((....(((......)))......(((((((((((((((..((((((((((((...)))))))))).)).)))))))))))))))((((.(((........)))..))))................)))))).((((((......((((((((((.((((((....((((..(((((((....)))).))).(((((...))))).....((((((((((((((((((((.(((....((((((((((((((((((...))))(((.((((.....((((((((..(((((((((.......))))).....)))).))))))))......(((((.....((.((.....(((((((....))...((.((((...(((((((.(((((.(((.((((.((((.((...(((((((((.((..(.(((((..((.(((((((..(((.(..((((((..(((((((.(((.....((..((((((..(((((((.....(((((((....((((((((.((((..((((((....)).))))...)))).).)).))))))))))))..(((((.((((((((((((((.((((((((((.......(((((...(((((..(((((..((((.((....)).))))..))))).))))).))))).))))).).....)))).))))))))).....((.(((((((.(.(((.(((.((((...(((((((..(((....)))..))))))).......))))))).))).).))))))).)).))))).)))))....((((((((((..((......))..))))))))))......))))))).....))))))..)).....)).).)...)))))).)))).))..).)))..))))))).)).))))).)..))..))))))))).......((((((((((((((....)))))...)))))))))......)).)))).)))).)))))))))))))))..)))).)).)))))......)).))..)))))..)))).))).(((((((((((((((((((((((((.((.((((...((((((..((...))..)).)))).....(((((((...(((....))))))))))...((((((((.(.............((((((((((((((((.(.....((((..((((.((((.(((.((((((((((((....)))))))(((((....(((.......))))))))(((((((((....((((((.(((..((((((((((((((.((((.((((((..(..(((((..(((.(.((((.(((((...))))).)))).).)))))))).)..)))).))...)))).))))..(((.(((.....))).)))...((((((.(((((((((.((((...((((..........)))).....)))).))))))))).))).))).....))))))))))..)).).))))))..)))))))))((((((.((((.((.((....)).))...))).).))))))......(((((((((.((...((.(((....))).)))).)))))))))..)))))..))))))).))))))))......).)))))).))))))))))..).))))))))..)))).))))))))))))))))))......((...((((....((((..(....)..))))....))))...))(((((((((.(((((((((.((..(((.((..((((((......))))))..)))))(((....)))..........((((..........)))).)).))))))))).)))))))))((((((..((((((..((((.......(((........)))))))))))))..))))))....)))))))))((...((((((((((((((.((((..(((.(((...(((((.((((((.((((.((((((((((((((((((........))))..(((.((((.(((((.((((..((((...(((..(((.(((((....)))))..)))..)))....((((.(((((((.(((.(..((....))..).))).))))))).)))).)))).....)))).))))).)))).))).....(((((((..((......))..)))))))))))))))).)))))...))))(((((..(((.((.((....)))).)))...)))))))))))..)))))))).)))..))))(((.((((.(.((((((.((((((((.(((..((((..(((.(((.....(((((...((((((((.(.((((((......((((.((..(((((((....((((((((.(..(((....(((...))))))..).)))))))).)))))))((((((.((..(((((((((((.(((((...(((((.((..((((.(((.((((....((((..(.((((((((....(((.((((((((.((((.((((....(((((.((((................)))).)))))..(((.((.((((....)))).)).))).(((((....)))))))))(((((....((((((...(((((.(.(((((((((((((((.(((((.(((.((((...((((((.((.(..(((..((((..((((((((((.....((((......(((((....)))))(((((.....(((((((.....((((..(((((..(.((.(((...))).)))..)))))..)))).....)))))))(((....)))..))))))))))))))))).)).))))..)))..).))))))))....)))).))).))))).)))).))))))))))).).)))))(((((((((((.((.((((((((((((((...((((((.((.((((....)))))).)))..((((((((.(((((..((.(((..((((((((((((((.((((....)))).)))(((((....)))))((((((((((((.((((((((((...)))))))...))).))))))........)))))).(((.((((((.(((..((((....((....))...))))..))).))))))..)))...))))..))))))).)))))..))))).))).))))).)))...)))))).((((((..(((.((......))))))))))).((((..(((((((.....))))..)))....)))).)))))))).)).))))...)))))))((((((....(((((((((....((...(......)..))..)))))).)))...)).))))...))))))..))))).(((((....))))))))))))))))).))).((((((((....))))))))((.....)).)))))))).)..))))..))))))).))))..))..)))))..))))))).............(((((((((......)).)))))))..)))))))))))))))))..))))))......)))))).)))))))))...)))))))).)))..)))))))...)))))))).)))))).))))).))).(((.(((.((((((((((((..((.(((((((.(((((((((((((((((((((((((((((((((.((((...)))).((.((((((...(((((((...((......)))))))))..(((((.....))))).......((((.(((.((.....))))).))))...))))))))))))))...)))))))....(((((((((((...(((((.((((.((.......)).))))))))).((.(((((....))))).))((((((.......))).))).)))).)))))))...(((((((((.((((.(((.((.(((........))))).))))))).)))...(((((((.(((((((..(((.((.((((.(((.(((((((((((.((((((((...(((..((((..(((((..(.((....)).)..)))))...))...((((((.(.....).)))))).))..)))...)))...)))))))))))))(((((((..((((...((..((((........(((((...(((.(((......))))))..)))))......((((((.........))))))...((.(((((((((....((((.......)))).))))))))).))))))..))...))))(((......)))...)))))))((((((....((((((((((...........)).))))))))..(((((((..((((((..........))))))....)))))))((.....))..((((.((.(((..((((....(((((.(((....))).))))).....))))..))))).))))..........))))))..)))))).)))))).)))))).)))).))))))).(((((((.((......))..))))))).))))))...(((((((.(((((((...........((((((..((....))..)))))))))))))...))))))).((..((((.....))))..)).))))))))))...))))))))))........))))))))).............))))))))))....)).))).)))..)))))))...)))))))...)).....)))).)))))).)))).))).).))))(((..(((((.......)))))))).......................((((((.((((((((.((((((((....((((...((..((.(((......))).))..))))))..(((((((.....((((((.(((.....))).)))))))))))))(((((((((......))))))))).............((((((((((((...(((((..((((((((((((......(((((.......)))))......)))).))))))))....))))).)))))).)))))).)))..)).)))..))))...)))).))))))..))))))))))).))))(((((((..(((((...........(.....((((....(((...((((((.........)))))))))..)))).....)..........)))))...)))))))..))))..))))))..))))))))))))))))(((((((((((......((((...((((((..(((...........(((((((.....)))))))............)))..))))))..)))))))))))))))....))))).))).))))..........................
Thermodynamic Ensemble Prediction
((((..(((....))).)))).((((((((((((((((,..(({..((((((((,......(({........,......(((((((((((((((..((((((((((((...)))))))))).)).))))))))))))))){(((.(((........))),.)))),....))))))))..})).,.,.((((,,..}}}}|(((((((((.(,((((....((((,.((((,,,..,})),}.}}},(((((...))))).,|||((((((((((((((((((((.(((....(((((((((((((({(({...,))}{{{.((({.,...((((((((..((((((({{.......}}})),....)))).)))))))).,{{{,(({{(,.,,{((,((,.,{{((({{({....}},,.((.((((...((((((,,(((((.(((.((((.((((.((...(((((((((.{{..(.(((((..{{.(((((((..(((.(..((((((..((((((,.{{(..,..((..((((((..(((((((.....(((((((....(((((((,,((((..((((((....)).)))).,.)))).).)).)))))))))))),,(((((.((((((((((((((.(({{,{((((..,.,{.(((((...(((((..(((((..((((.((....)).))))..))))).))))).)))))....)).)..))))))).))))))))).....((.(((((((.(.(((.(((.((((.,{(((((((..(((....)))..)))))))...,}..))))))).))).).))))))).)).))))).)))))|,..((((((((((..((......))..))))))))))......))))))).....))))))..)).....)).}.....)))))).)))).))..).)))..))))))).}}.))))).)..}}..))))))))).......((((((((((((((....))))),..,))))))))......)).)))).)))).)))))))))))))))..)))).)).}))))...}},))}}}..))))).}))}}.))),(((((((((((((((((((((((({,((.((((..,(((({(.,((.,,}},.|||,|||{{...(((((((...{((....)))))))))}...{{||||{{,|.,.....,,....((((((((((((((((.((((..((({,.((((.((((.(((,((((((((((((....))))))){{(((....(((.......})))))}}{{({(((((,.,,((((((,(((..({{(((((({((((.((((.((((((..{..(((({..(((.{.((((.(((((...))))).)))).}.)))})))).,..)))).))...)))).)))),.(((.(((.....})),)))...{{{(((.(((((((((.((((...((({..........)))).....)))).))))))))).))).))).}...}))))))))),,)),).))))))..))}))}))){{{{((.,(({.({.{{....)),))...})).),))))))......(((((((((.((...((.(((....))).)))).))))))))).,))),)},}},)))).))))))))....,)),))))))}})))))))))..,.)))))}))..)))).)))))))))))))))))).,,..{((...{|||..,,((((..(....)..))))....}}}}...))(((((((((.(((((((((.((..(((.((..((((((......)))))).,)})))(((....)))..........((((..........)))).)).))))))))).)))))))))((((((..((((({.,((((.......(((........)))))))))))))..))))))....)))))))))((|,,((((((((((((((,((((..(((.((,..,(((((.((((((.((((,((((((((((((((((((........))))..{((,((((.,((((,({((..{{,....{||..{{(,({{||..,,)))))..|||..}}}..},||((.(((((((.({{.{..((....)),,}.}}}.))))))).))}|,|{|,,..,,,}||.))))),))))}))),,...(((((((..((......))..))))))))))))))))},))))...)))}(((((..(((.(,|((....)))).))}...)))))))))))..)))))))).)))..))))(((.((((.(.((((((.((((((((.(((..(((({.(((.(((.....(((((...((((((((.(.((((((.{{...((({,((..(((((((....((((((((.,..(((....(((...))))))..,.)))))))).)))))))((((((.({..((((((((({(.(((((...(((((.((..((((.(((.((((....((((..{.((((((((....(((.((((((((.((((.{{{{....(((((.((((................)))).)))))..(((.((.((((....)))).)).))),{((((....)))))||}},((((....((((((...(((({.(.(((((((((((((((.(((((.(((.((((...((((((.((.(..(((..((((..((((((((((.....((({...|,.(((((....)))))(((({..,.,(((((((.....((((..(((((..,.{(,({,...,)),}}}..)))))..)))).....)))))))|((....))}..})))))))})))))))).)).))))..))).,).))))))))....)))).))).))))).))))},)))))))))|,|,|||}}(((((((((({.((.((((((((((((((...((((((.{({((((....)))}|},}}}..(((((|{,,(((((..((.(((..(((((((((({(((.((((....)))}.)))(((((....)))))((((((((((((.((((((((((...)))))))...))).)))))}.......,)))))).(((.((((((.{((..((((....((....))...))))..))}.))))))..)}}...)))),,})))))).)))))..))),)})}).))))).)))...)))))).((((({..(({,((......}})))}))))).((((..(((((((.....))))..)))....)))).)))))))).)).})))...}))))))||||||,...{{{((((((..,.((....,,....),.))..)))))).)))..,)),))),..,)))}})..)))},.(((((....))))))))))))))))).))).((((((((....))))))))((.....)).)))))))).}..))))..))))))).))))..))..)))))..))))))).........,...(((((((((......))}}})))))..)))))))))).))))))..))))))...},.)))))).)))))))))...)))))))).)))}.)))))))...)))))))).)))))).))))).))).,,|,|{{|{{((((((((((..((.(((((((.((((((((((((((((((({(((((((((((((.((((...)))).((.((((((...(((((({...((......}})))))))..(((((.....))))).......((((.{((,(,....})}))).))))...))))))))))))))...)))))))....(((((((((((,,.(((((.((((.((.......)).))))))))).,,.(((({....})))).||,(({((....,.,)}),,)).)))).)))))))...((((({((({(({{{(({.((.{((........)))}).})))))).|||...(((((((.(((((((,.{((.((.((((.(,{(((((((((({({((((((((.,.(((.{({((,.{((((..{.((....)).}..))))),,.)).,.((((((.(.....).)))))).}),.))).,.))}..}))))))))))))){{(((((,.{,||.,.|,,.,{(({.......||||||||{,{,({{.,,,,,}}}}}}..,}}}}......((((((,.......,))))))...{{.(((((((({....((((.......)))).})))))))).)}}})},}}}}.|}}}}{{{......}}}...}}}}}}}((((((....((((((((((...........,.,))))))))..(((((((..{{(({{..........})))}}....))))))){..,{,,{,..,|||||{.|||,,{{((....(((((.{{{....))).))))),,...}})}..,,))}.},............))))))..)))))}.)))))).))))))}}))).))))))).,{{{{{{.|,......,)},)))}}}}.}})))}...{((((((.(((((({..........,((((({..({....)},,)))))))))))))...))))))}.{{..((((.....))))..},.})))))))))...))))))))))........))))))))).............))))))))))....}}.||}.||...)))))))...)))))))..,)}.....)))).)))))).)))),}}}.}.))))|||..{((((.......))))}))),....|||..........,,.,.((((((.((((........,,(((....,,}|}.||{,,{{.,,,.,},.,))),}}|,|,((({.{((({{{{..,,.((((((.(((.....))).))))))})),,))..,,,||)}.}))).,}||||||,......,,.....((((((((((((...(((((..((((((((((((......(((((.......)))))......)))).))))))))....))))).)))))).)))))),,,},......)}})},....)))).))))))..))))))))))).))))(((((((.,(((((..............,..((((.,,.({{...((((((.,.....,.))))))))}..)))).....},.........)))))...))))))).,))))..})))),..)))))))))}})))))(((((((((((,.....{(((...,{{{{((((({....,,.....{((((((.....))))))).......,}...))},)))),}},.))))))))))))))).....)))).))).))))..,,,,,........,,,,,......

Transcripts

ID Sequence Length GC content
GGCUGAGUUUUAUGACGGGCCCGGUGCUGAAGGGCAGGGAACAACUUGA… 5490 nt 0.5220
Summary

This gene encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues such as skin, lung, uterus, intestine and the vascular system, frequently in association with type I collagen. Mutations in this gene are associated with Ehlers-Danlos syndrome type IV, and with aortic and arterial aneurysms. [provided by R. Dalgleish, Feb 2008]

Forensic Context

A study in human heart tissue demonstrated that the COL3A1 mRNA levels were independent of post-mortem interval in samples with non-degraded RNA, showing similar expression between long and short post-mortem interval groups [Partemi et al. DOI:10.1016/j.forsciint.2010.07.005]. In a separate study using mouse cardiac mesenchymal stem cells, the COL3A1 was identified as a downregulated hub gene in cells overexpressing HDAC11, indicating its role in transcriptional reprogramming associated with cell proliferation [Zhang et al. DOI:10.3390/biom15050662]. A study in human bone samples with post-mortem intervals of 15-20 years identified the COL3A1 as a key protein marker for long-term PMI prediction when screened using a random forest algorithm, achieving 100% differentiation accuracy in the model [He et al. DOI:10.1007/s00414-025-03625-9].