Basic Information

Symbol
COL4A1
RNA class
mRNA
Alias
Collagen Type IV Alpha 1 Chain Collagen Alpha-1(IV) Chain Collagen Of Basement Membrane, Alpha-1 Chain Collagen IV, Alpha-1 Polypeptide Collagen, Type IV, Alpha 1 COL4A1 NC1 Domain EC 6.3.1.2 EC 3.4.23 Arresten COL4A1s PADMAL BSVD1 RATOR BSVD
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001845.6
Sequence length
6540.0 nt
GC content
0.5518

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2692.40 kcal/mol
Thermodynamic ensemble
Free energy: -2796.47 kcal/mol
Frequency: 0.0000
Diversity: 1421.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.(((((......((((((......))))))((((.(((((((......))))).)).))))((((((((..(((((....)).))))))))))).((((((((((((((((((.((.(((...))).)))))(((.((((.....))))..)))...((((....((((((.((((((...(((((.((((..(((((((......)))))))..)))))))))(((.((.((....)).)).))).))))))))))))......))))....)))))(((((...........(((((((((....(((((((((......(((((.((((((...(((.((.((((((.....(((.....((((....(((((....))))).......((..(....)..))(((((((((.....))).))).)))...)))).....))).....)))))).......)))))....)))))).))))))))))))))..))))))))).....))))).((((((((...(((((((((((...(((((((....((((.....))))...)))))))...)))))......(((((..(((((((...))))))).....)))))(((((.(((.((...((((((...(((..((((((....)).)))).)))(((((((.(((((((((....)).....))))))).)))))))......))))))....)).))))))))..))))))...))))))))..)))))...))))).....(((..((((((((...((((....(((.((....)).)))....))))..(((((.(((.((....)).)))...))))).............)))))))).))).))))))))))((((((((.....((((((((((.....))))..((((..(((((.(((.(((..(((..(((.((((((((.((((((.........(((..................))).......)).)))).)))))))).)))..))).((((.(....)))))...((((.....)))).(((((.(((....(((((((((((...(((((((...(((((((((.(...(((...((((((((.((..(.....((((....(((((.((((((....))))))((....))..((((((((.....(((...((((((...((((((...((((((((((......((((((.((((.(((.(((((((.....)))))))))).))))..)).))))....)))).(((.(((....)))))).(((((((.(((........))).))))))).....))))))...))))))...))))))...))).....)))))))).(((((......))))).......)))))....))))...)..)))))))))))))).)))))))))...)))))))............((((((.((..((((((...(((((((......)))((((((.......))))))...(((((..((((........)))))))))((((((......))))))(((((((.((((((((..(((.(((.((((...((((((((....((......))....))))))))))))........((((((((....((((((((((((((((..(((((((((((((((((.......)))))))(((((...(....)....))).)))))))))))).((.....))(((.(((((((((((.(((((((((((((((((..(((....)))..)))))).((((...(((((((.((((((((((.((((......((((((((((((((((((((((((((......((((....(((.((((((..(((((..(((.((((((((((((...((.((((((.((((..(((....))).)))).)))))))).)))))))))))).((.(((((.(((((...))).))...))).)).))(((((......)))))...(((((....))))).((((.....)))).(((((((((((((..((((..(((((..((((.((..((((((((.((....)).)))))))).(((((((.((............))))))))).....(((.((((....)))).)))(((((((((((....((((..(((.....)))..)))))))))))...)))).(((((((.((((.((..(((((((.((..(((.....(((.(((((((((((((....(((((.((((((..(((((((....)))).))).......)))))).))))))))...))).))))))).)))....)))..)))))))))...)).))))..)))))))..((((((((..((.((.((((((.....)))))).)).))(((((.(((((....))))).)))))..))))))))(((..((((((((((((((((....(((((((((..(((((((((((......((..((((((...((((((.....((((((((((........)))).....))))))))))))..))))))..))((.....))(((((((............)))))))..)))).)))))))....(((((..((((((....))))))..)))))..)))..))))))))))))))))))))))..))).))))))..))).))..)))).))).)))))))))).)))..)))))..)))))).)))...)))).))))))......))))).......)))).)))).)))))))....)))))))))))).)).))).))))))))............)))))))).))).))))))))))).)))))))))).)))....((((((((((((((.......(((((((...((...((((................))))(((....)))......((.((((.(((....)))))))))(((((....)))))...((((((.(((((((((((((((((....)))))((((...((.(.((((........)))).))).)))).(((((((.(((((.(((((....)).)))....((((..((((..(((((((.((((((........)))))).)))))))..))))..))))....(((((((.((...(((((.((.....((((...(((.......((((......)))).))).)))).....)))))))...)).)))))))..((((((((..(......).)))))))).))))).)))))))....((((((.....((.((.(((((..(((.((....)).)))..))))))).))......))))))(((.((((((((((((((((((.(((((((((.(((((......((((.......))))(((((((..((((.((.(((((........))).)).))..))))))))))).(((((((((((..((((((.(((((((.....((((..(((........)))..))))..))))))).(((((...((.....))...))).)).((((.....))))..))))))...))))))..))))).....(((((...(((.((......)).))).)))))..)))))))))))))).)))))))))((...))((((((((((....(.((((((..(((((((((((....(((((((...(((((.(((((.(((...)))..((.((((((...(((((((((.((..(((..(((((((((((((((((..((((((...((((((.(((((((...))))))).)))).))...))))))...))).....)))....)))))))))))..)))..))))))((((((..((((...((((..(((((((((((((((..(((.......))).)))))...)))))).))))))))..))))....)))))).(((.((((..((((((.....(((.((....))))))))))).))))..)))........(((((.....)))))....(.((((((((((...)).)))))))).))))))))))))))..(((.....))).........))))).)))))...))))))))))).)))))))..)))))).)..((.(((..(((.((....)))))..))).)).....(((.(((.(((((..((((((((((((((....))))))))..(((.(((((((.(((((..(((.((..(((((((((((((...((((((((((...(((((....)))))...))))))....((((((.(((((((.....)))))))))))))....)))).)))))))((((....)))))))))).)).)))))))).)))))))..)))...))))))...)))))..))).))).........((((...)))).)))))))))).(((.((......)).)))((((...)))).(((((((.(((.(((.(....).)))))).)))))))))).)))))))))..)))))))))...........((((((((....)))).))))..((((....)))).))).)))))).)).))).)))).)))))))))).....))))((((((((((((.........(((((......((((((((.((.......)))))))))).)))))..(((((((.((((((..((((((..........((((......))))))))))...)))))).).)))))).))))))))))))..(((((....))))).........)))))).)))))))).)))))).)))))))).)))((((((...(((((((((((((...(((((.((.(((((.(((((...(((.........)))...(((...)))(((((((((((..((.......)).)))))....))))))..))))))))))..))))))).(((((.((.(((((....))).))...)).)))))...((..((((.......))))..))....((((.........))))....))))))).)))))).))))))((((((......)))))))))).........)))).)).))))..)).))))))........((((((...(((...)))..))))))............)))))))))))....))).)))))(((((.((....((((((.(((((((..((((.((((.(((.....))).)))).)))).((((..............))))((((......))))((((((.(...(((....)))))))))).........((((.......((((((((.....))))))))....))))..........................(((((......))))).........)))..)))).))))))..)).))))).......(((..((.((((((((......................(((((...)))))(((....)))..)))))))).))..)))...)))))).)))))...)))).....(((((((((((((..((((((((.((((((....((....))(((((((((....((((...))))...(((((((((............((((((((((((....))))))..)))))).......((((........))))....(((.((((.((((((.......)))))).)))).))).................((((((((((((((((..(((((((.((((((((.(((.(((((((...(((((.((((((.((((.(((((.((.(((..................)))..))...((((.......)))).))))).)))))))......((((((((.(((..(((((((.((.((((((((.....((..........(((((......................))))).......))...)))))))).)).)))))))..)))..))))))))...)))..)))))...)))))))))).))))))..)).)))))))..)))))).)))).))))))...............)))))))))..)))))))))..((((((((....))))..)))))))))).))))))))....)))))))))))))(((((.((....)).))))).......))))))...(((((..............))))).....))))))))..(((((((((((.(((((((......................((((((((((((((......))))..)).))))))))..((((.((.......)).))))))))))).))))))).))))((((.(((((((..........)).)))))))))..)))..
Thermodynamic Ensemble Prediction
{(((((((.(((((,,....((((((......)))))){(((.(((((((......))))).}).)))}((((((((,.((((,..}})).,)})))))))).((((((((((((((((((.((.(({...})).)))))(((.((((.....))))..))}}.,((((...,((((((.((((((...{((((.((((..(((((((......)))))))..))))))))|(((.((.((....)).)).))),)))))))))))).,....)))),...)))))(((((,...,......(((((((((.{..(((((((((,,....,((((.((((((...(((.{(.((((({.....{((,,...((((....(((((....)))))......,((..(....)..))|((((((((.....)))..|||||....)))),....))),,,..)))))),,.....)))))....)))))).))))))))))))))}.)))))))))...,,)))}|.((((((((...(((((((((((...(((((((....((((.....))))...)))))))...))))),.....,((((,{((,((({{,.,,|||||....{{,|||(((({.(({..,,,,,,,,,,,..,..}}))|)||.}}})).))}}}|||(((((((.(((((((,,....,,.....))))))).))))))),,,}},}}}})){{{{|,.,.))))),..})))))...))))))))..))))}..,))))).....(((..{(((((((...((((....(((.((....)).)))....))))..{((((.(((.((....)).)))...)))))..,,.........)))))))).))).))))))))),((((((((.....(((({{{{((,.,,||}||,.,{{||.(((((.((({{{,..(((..(((.((((((((.((((((.........(((..................))).......)).)))).)))))))).)))..))).((({.{,..,}})))...((((.....)))).(((((.{((....(((((((((((...(((((((...(((((((((.{..,(((...(((((({{{((..(.....((((....(((((.((((((....))))))((....))..(((((((({(...{((...((((((...((((((...(((((({{{,,,,,,((((((,.,,,{.|||.|||||||.{,{{}|}}||||||{|||,..,}.|}||....}|||,(((.(((....)))))).|||||||.|{{..,,,..,})),))}})})}}}..))))))...))))))...))))))..,)})}}}..}))))))).(((((......))))).......)))))....))))...)..)))))))))))))).)))))))))...))))))).....,,,,...((((((.((..(((((({{{(((((({.(((((((.((((((.......))))))..(((({...|))))((((.{.|({..{((|((((((......)))))).)))...))..}))))..))))))).((((...((((((((....((......))....)))))))))))).,((((((((({((((,...|||),{(((((..((.....)}..)))}||(((((.,,......}}}},)))))....((((((.{(..((..(((((({(((((({.,(((.(((.(((((((((((.(({(((((((({{{{{{..{((,,..}}|,,||||||,(((({..{(({(((.((((((((((.((((..,...((((((((((((((((((((.(((,,....}}||||}}..(((.((((((..(((((..(((.((((((((((((...((.((((((.((((..(((....))).)))).)))))))).)))))))))))),((.(((((.(((((...))),)}...))).)).))|((((......))))}...(((((....))))).((((.....)))).(((((((((((((..((((..(((((..((({{((..((((((((.((....)).)))))))).(((((({({(..........}.}}}}}))))..,,.(((.{(((....)))}.)))(((((((((({...,((((..(((.....)))..)))))))))))..,)))).(((((((.((((.((..((((((,{(({.(((.....(((.((((((((((({{....(((((.((((((..(((((((....)))).))}.....,.)))))).))))))))...))),})))))).)))....))).})))))))))...)).))))..)))))))..((((((((..{(.((.((((((,...,)))))).)).)}(((((.(((((....))))).)))))..))))))))(((..{(((((((((((((({...,(((((((((,.(((((((((((,,....((..((((((...((((((....,{{{({(((((........))))}.,..})))}}))))))..))))))..)){{.....||(((((((............)))))))..}}}}.}))))))....(((((..((((((....))))))..)))))..,,,,,)))))))))))))))))))))}..})).))))))..))).))..)))).))).)))))))))).)))..)))))..)))))).)))...}}}}.}}}|||,,....))))).,.....)))).)))),}))))))...,)))))))))))).)).))).))))))))............)))))))).})).))))))))))).))).)))))).)))}{(((((((((...(((.(((((.(((((....(((((((((..((((((({,{{{({...{{{(((....})}..,...((.(((({((({.{{,,||||,,|(((((((((((((({..,,.(((((.(((((...,((((((((..(((((((((...(({..((((........))))}))((((((((.(((((((((((.{{{((....}|.|||.{,,((((..{(((..(((((((.((((((........)))))).)))))))..))}}..))))....(((((((.((...(((((.((.....((((...(((.......((((......)))).))).)))).....)))))))...)).)))))))..,|.,,,||...(((({{(.{{{(((({,{{,.,{|||,,.,,...{{{{{{.....,{,({.{{(((..(((.((....)).))),,))})}}}|))...,,,)))))},}}}...}}.)))}))).))))))))))))}.))))))......{(((.......)))}(((((((..((((.((.(((((........))).)).))..))))))))))){(((((((((((...((((,.{{{||||.....,|||.,|||,,.,,,..|||,.}|||,,||||}}|.(((((...((.....))...))).)).{{{{...,,)))),.)))})}||.|||||||.,||||.,...,,{{{...{{,||||,{(((,{{(((.((.....))}})))))},(((((((((((,(((...(((((((.,{(({,...,||||||(((({(((((.((.....))))))),.))))}}}}}((((({,(((((..((({((((((...(((.((((.((..(((..(((((((((((((((((..(((((({{.{{((((.(((((((...))))))).)))).))..}))))))...))).....)))....)))))))))))..)))..)))))).)))..)))))).((((...))))...})))..)))))))))))........))))))).))).....,(((((((.......,.))))))))))))))))))).(((({....}))))....,}|}|||||||,..))})))),.......(((((.....))))).,|.,.((((((((((...}).)))))))).))))))}))))},.)))))))...,............))..))))))))|((((((((((...(((((....)))))...)))))..))))),)))))..))))).,(,(((.....|||,|}.({{{.....,,...}}})))),.)))))))))))))))))(((((((.(((({.,(((.((.,(((((((((((((...((((((((((...(((((....)))))...))))))....((((((,{((((((.....)))))))))))))....)))).)))))))((((....)))))))))).)).)))))))).))))))).........})))..}),))))}..}}}}}}....}))))).))...))).))))))))))).))))).((((..(((((((((((((((((.,(((..((((..((((((.((((..((((((,{{{,{.({({{.,|.......|||,.,},},,........{||||||,....{(((((((((({.({....,,{{.((((((((,{.((({(({,....(({({((....})))))....}||,))))}...,,{{,,,.{{{{{{,...{||||||{.||.,},}}..,||||}}||{{|||,.}}}))|)))|})))))))}}.............(((..((.(((((((....})}))))).))..)))....}}))))))))))))..,,,},}}},))))))..))))))))))..)))){(((((,{,,.((({{{{,.,.,,})))))}..}..}.)))))}......,}}.)))..))))))))).))},...........((((.(((...))).)))),(((((..{(.....,.}).)))))..)))))....))))..)))))))))))))..(((((.((.{(((({......}),}}})).)))))...(({........,,..},....})))))))..))..))..))))))....))))).))))),}}))))))}|||,,..,,,.,,,,,......,.......,,))})}.))))..)).)))))).,......((((({.,.(({...)))..))))))............)))))))))))....))}.)))))(((((.((....((((((.((((,{{..((((.((((.(((.....))).)))).)))).{{,,.,,,,{,....}}}))}.((((......))))((((((.{.,.{((....)))))))))).........{(({{,.,{,.((((((((.....)))))))).,}}))))..,,.,,.....,.,,,,....,,,,{{(((......})))},,,,,....))}},)))).))))))..)).))))).......(((..((.((((((((.............,,,......(((((...)))))(((....)))..)))))))).))..)))...}))))).)))))...,,,,.....(((((((((((((..((((((((.((((((..,,((....))|((((((((....{(((...)))}...{((((((((............,,{{{,.,{(({,,,,||}|},..,}}},)}}}},,||{({.,,.....})),,,,.,{{.((((.{(((((.......)))))}.)))),|||,,...{,...,,.....((((((((((((((((..(((((((.((((((((.(((.(((((((...(((((.(({(((.((((.{((({,{{.{{{......,,,.....,,.,|}|,,,,...{{{{.......)))),))))).))))))}...,..{(((((({.{((..(((((((.{(.((((((({,,,,,(...........{{|||}||..........,,.......}}}}},,,..,||,..,}))))))).}}.)))))))..)))..}))))))),,,}}},.)))))...)))))))))).})))))..)).)))))))..)))))).)))).))))))...},}))}......)))))))))..))))))))}..{{{{{(({....})))..}))})))))).))))))))....))))))))))))),{{((.((....)),))))),,.....})))}}...(((((.........,,...))))).....))))))))..(((((((((((.(((((((..,,,....}},......,..,((((((({{{{{||,.....}}}|,,}}.}}}}}))).,{(((.((.......)).)))}))))))).))))))).))))((((.(((((((.,,.....,.)),})))))))).,)))..

Transcripts

ID Sequence Length GC content
AGGUCUCCGCUUGGAGCCGCCGCACCCGGGACGGUGCGUAGCGCUGGAA… 2575 nt 0.5200
AGGUCUCCGCUUGGAGCCGCCGCACCCGGGACGGUGCGUAGCGCUGGAA… 6540 nt 0.5518
Summary

This gene encodes a type IV collagen alpha protein. Type IV collagen proteins are integral components of basement membranes. This gene shares a bidirectional promoter with a paralogous gene on the opposite strand. The protein consists of an amino-terminal 7S domain, a triple-helix forming collagenous domain, and a carboxy-terminal non-collagenous domain. It functions as part of a heterotrimer and interacts with other extracellular matrix components such as perlecans, proteoglycans, and laminins. In addition, proteolytic cleavage of the non-collagenous carboxy-terminal domain results in a biologically active fragment known as arresten, which has anti-angiogenic and tumor suppressor properties. Mutations in this gene cause porencephaly, cerebrovascular disease, and renal and muscular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Forensic Context

A study in mice selectively bred for high or low methamphetamine intake identified the COL4A1 as a gene overexpressed in the ventral midbrain of the low-drinking line and as an extracellular matrix component [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human neonates with hypoxic-ischemic encephalopathy, the COL4A1 was a significant gene over time associated with adverse outcomes in a high-income country cohort, identified as a HIF1 target with expression increasing after oxidative stress [Montaldo et al. DOI:10.1001/jamanetworkopen.2023.54433]. In human corpus cavernosum tissue, single-cell transcriptome analysis revealed that the COL4A1 had higher expression in fibroblasts from patients with erectile dysfunction compared to normal controls, and its expression was upregulated in fibroblasts treated with a WNT pathway activator in functional experiments [Zhao et al. DOI:10.1038/s41467-022-31950-9].