Basic Information

Symbol
COL4A2
RNA class
mRNA
Alias
Collagen Type IV Alpha 2 Chain Collagen Alpha-2(IV) Chain DKFZp686I14213 Canstatin FLJ22259 Collagen Type IV Alpha 2 POREN2 BSVD2 ICH
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_001846.4
Sequence length
6446.0 nt
GC content
0.6184

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2943.30 kcal/mol
Thermodynamic ensemble
Free energy: -3039.82 kcal/mol
Frequency: 0.0000
Diversity: 1716.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.(((.(.((.(.((....)).).)).).)))..))))))))....(((.((((.((((((...(((((.((.((.((.(((.(((.(((.......))))))..((((((.(((((((((((((((((((((...................)))))))((((((((((((...)))))))))).))..))))..))))........))))))....))))))))))))).)).))))).....))))))....)))))))..((((((((((((.....(((((((((.(((((..((.((((.(((((((((.((((.((((.(((..((..((.(((((((.(((.((.((((((.(((.((((.((((.(((.((((((((((..((((((((.((((((....((.((........((((.(((((((((((((.(((((........))))))).))).))))))((((((((((((((((.(((((.((.((((((.((.((........((.((((((((((...((.((.(..(((.((..(((((((..((((((.((((((.((..(((((.(((..(((.((..((((((.((((....)))).).)))))..)))))..)))...)))))...)))))))).(((((((((((((((...(((((((...((.((....)).))...(((..(((((((((((((..((((..(.((((((.((((.((((((((((((((((...))))))......((....)).......))))))))))..((.((.(((....))))).))..))))..)))))).)..))))..)).))))........))))))).)))....))))))).)))))))).((((((...(((((((((..((((...(((((((.(.(((((....))))).).)))))))))))..)))).((...)).......(((((.((....)).)))))..(((((...((((((.(...(((...(((........)))...)))....).)))))).)))))..)))))...))))))....))))))).(((((............)))))....(((((((.((((((..((.((.......(((.(((((((...(((..............(.(((((((((...(((((((....))))..((((.(((((........))))))))).))).))))))))).)..(((((..((((((((......)))))).)))))))..))).))))))).)))......)).)).)))))).).....)))))).))))))))))))))))))......).)).))...)))..))))))).)))).))))))))(((((.(((.(((.(((.((((..........)))).))).)))..))).)))))(((((((((.((.((........)).)))))))))))(((((((...((((((.((....)).))))))......)))))))....)).)))))..))))))))).)))).)))(((((...((.(((((((((.(((((((((((((.((((((((...((((((((....(((.(((..((((((((...((((((..((......(((((((((((((((((((((((((((((((.(((.(((((((....((((.....((((...(((((......((((.(...((.(((......))).))..).)))))))))...))))...))))...)).))))).))).)))..))))))))))))))....((((.(......).))))((((.....)))).((((((....))))))))).)))))).)))))......))..))))))))).)))))))))))...)))....))))).....((((........))))((.(((....))).)))).))))).).)))))))......(((((((.((((.(((((((.(((.((((((((..(((..((((((((((.((.((((((...((((....)))).))))))((((.((((((((......((((((....)))))).....)))).)))).))))...(((((..((((((..((((((((...(((((...)))))......((((((((((((.(.((.((..((((((.......((((((((((((((((((((.(((...)))...)))))((((.....))))..(((....)))...))))))((((....))))...)))))))))......)))))).))...(((((((((..((...((((...((((.((((.((((..(((((....(((.(((..(((.(((...(((.(....).)))...))))))..)))...))).)))))..)))))))).))))....((((((((((..(((((((((((((.(((((((.....(((.((((..(.(((....))).)..((((((.....))))))......((((((((.(((((((((((....))))).))))))...))))))))..))))))))))))).)..)))))))))))))((((((((((.((.((((.(.((((...((((((..(((((((((((...((((((...(....).))))))(((.(((.(((....))).))).)))...(((((((.(((..(((((......))))).))).))))))).....((((((((((((((((((..((((((((((((.(((.((..((((((((..(((((((((..((((...))))..))))((((((.....((((((.....)))))))))))).....)))))..))))))))..)).))).))))))(((((.((((((.....(((((((((....))))))..((.((((((((.((((((.((..((((.((((((.(((((.((((((.......(((((((...(((((((...)))))))......(((.......))).(((((((((..((((((((...((.(.((((((..(...(((...)))..)..)))))).)))...(((..((((((((((((((((........)))))))))))))))).....))).((((((...((..(((.(((....))).)))..))))))))..(((((.((.((((......((((.....))))..))))..)).)))))......(((((...)))))....((((((((.........))))))))..)))).))))..))))))))).)))))))))))))..))))).)))))).))))(((((((.(((..((((((..((.((((...((((((...))).)))...)))).))..)))))).))).))))))))).))))))(((((..(((...)))..)))))....)))))))).)))))....)))))))))))....((((((((....(((.......)))..(((((((.((.((((.(......).))))...)).)))))))......))))))))..((((((((.(((((((.((((....)))).((((......(((((....))))).....)))).)))).).)).)))))))).((((..(((......)))..)))).))))))((((........))))...)))))))((((...(((.(((((((.(((((.(((.(((......))).)))...)))))..))))))))))...))))....))))))))))))))).)))))))..))))))...)))).))))).)))).)))).))))..))))))))))..))))))..))))))))).((.((.((...(((((...(((..(((..(((((((((....((((((((((((...........)))))))).))))...........)))))...))))..)))..)))))))).)).))))..)).))))))))))))))))))))))))))).)))))(((((((..((((((((((...((((.....((((((..((((((((.((.(((........))).)).))))))))...((((((...))))))..(((((((....))))).)).(((......))).....)))))).....))))..)))))))))).)))).))).((..((...))..))...))..))))))))))..(((((((((.((((.((((((((((....((((((((..........((((((..(((........(((((.((..(..(((((..(((...))).)))))..)..))))))))))..))).)))..))))))))(((..((((((((.((((((((((.(.(((....(.(((((..........((((((........((.((((......)))).)).((((((((((((.(((...)))))))))))).)))))))))...((((((....))))))))))).)..))).).))))).))))).))))))))..)))((((((........((((((.(((((.((.(((((((...))))))).).)..))))....).)))))).)))))).....(((.....))))))))))))))))).))).))))))((((...))))......(((((..((....))..))))).((..(((((........)))))..)).))).))))))))))).))..))))).........(((.(((((((...(((((.(((((((((.(..(((((((....((((((...(((((....((((((....))))))..))))).((((..((.((((((((............)))....))))).)).))))......(((((..(((.(.....))))..)))))..........))))))(((((((.(((((((.(((((((.............(((.....((..((((((((.(((((((((((....(((....)))(((.((((((((((...(((((....)))))..(.((((((....)))))).)....))))))))))))).......))))))))))).))))))))..))....)))..)))))....)).)))))))..))))))).((((...))))..(((((((...((((((((...))).))))).)).)))))..))))..........)))..))))))))))....)))))....))))))).)))..((((((...))))))(((((((...(.(((((.....((((((.((((..((((((....(((...)))....))))))...........))))))))))))))))..)).)))))....(((((((..((((((..............(((....)))......(((((....(((((((........)))))))....)))))))))))..))).))))..((((.........))))..)))).)))))))...((((((....))))))))))))(((..(((((.....))))).))).......))))..))))).))..)))))..))))))........)).))....))))))..)))..)))))...)))))))...........(((........))).........(((...((((((.(((((......))))).))))))..))).........(((.(((.....)))))))))))).))))...))))..))))))))))))))..)))))))))..)).)))))))))))))))).))))))))((((((((((...(((.((((((.((((((.(((......((((((.(.(((((.(((((.((((((((......))).)))))..............))))))))))).))))))((.((......))))..........))).)).)))).)))))).)))...)))....)))))))........((((....)))).(((((........)))))..((((....))))))..))).)).)))))).)))...((((..(((((((((...........(((.(..(((((((((.....)))........))))))..).)))((((((((..............((((.((((....))))))))...))))))))...........(((((((((((.(((((.......)))))..)))))))))))(((((((((......)))))).)))........((.(((....))).)).........(((((......))))).)))))))))))))))))))))...)))).............
Thermodynamic Ensemble Prediction
((((((((.,((.({(({((((....)).}))).,,)))}.))))))))..{.(((,(({(,((((((...(((((.(({(({(,..,|}|||.,,,.,}}}}})),,,,..((((((,(((((((({{{{{{(((({{{.,{{,{,,.{{,{.{{..,|||||||((({{{{{||||.,,))))}))))).)).,))))..}))),...,.,})))))).,..)))))),.||||,.,,.,,,))}}...)))))).}.,,)))))),.((((((((((({,,.,,(({((((((.{((((,,((,((((.(((((((((.((((.((((.(((..((..((.(((((((.(((.((.((((({{(((.((((.((((.(({{((({({{({{..{..(((((.(((((.,(((((.,...((({.(((((((((((((((((,{.(((((.,......))))),}.))).))))))(((((((((..((((..(((((....((((((.((.{,.......(((.((((((((((.{.((.((.{..,{{,(,.,(((((({..((((((.((((((.((..(((((.(((..(((,.(,.((((({.((((....}))).}.))))),,}))))..)))...)))))...}))))))|,,(((((({,((((((,..({((((({,.{,.{{{{{.|..,((..(((.{((,,,(((((((((.{,((..({((((((.(((,.((((({{,((((({{,,,,)))))),..}}}}}...,||||.....|}},,)))))..,({(({(((.....||,|{||{{,,||,.,|||||,|..||||{{|{{||,,....,,}.,})))))})),.,.||||||||,|||||,||.{,(((,.{{(,,(((((({{,(((...(((,((,.,.||,||}}}},))))})}),))),,))),..},,),|,..,}}.......(((((.((....)).)))))..(((((...{(({({.|.,,|{|,..|||,,......}}},..|))....).)))))).))))),})),))}}}))),}|{{,,.,,}))},(((((............)))))....|||||||},|||||..||.{{.......,,(.(((((((...|||.....,,,,...,.{.(((((((((...(({((((....))))..((((.(((((........))))))))).))).))))))))).|{{((,,,..||||.||..}}}}}))),),.)))})))..))}.,}),}),.)))}.,}.})).)).))))))}).}}}}))))},.))))))))))))))}}))......,.)).)).,.)))..))))))).)))}.)))))))).((((((((.(((((((..((((((((.((((.,((.((((.,(((.{((|{{{{(((((((((.((.{{,,,....,)).))))))))))){{{{((((..,,{{{{}||,...))}}})|||.....{||||||,((((((((((((..(((((((((..{((.(((..((((((((((((((((((.((.,,,||,|}|((((((((..(((((,,((((..{((((((((((((((((((...((((((..{{......(((((((((((((((((((((((((((((((.(((.(((((((....((((.....(((,...(({(({.....{(((.{...((.(((......))).))..,.)))))))}),..,)))...))))...)).))))).))).))}..))))))))))))))....((((.(......).))))((((.....)))).((((((....))))))))),,))))).)))))......}}..))))))))).))))),|||||....||.,.,))).,.....((((........)))){(,(({....)))|||,((((((({|.(((((((,,....{{,..{..((((((((({((((,...,{||}|{..,{|,.||||{((((((..{((((((...(((,.{{{,,,,.,|||||{.{(((((..(((.((((.((((((....)))))).....(((((.(((.|(((((,{((((((.........))))))..((((((((...,(((....|}|}|(((((((((((.((((,({.(((.,....((((((,{(({.(((((((((((,(({...)))...)))))((((.....))))..(((....)))...)))))),{,|,,,,,..}..,,.((((((((((((.((((((......((.((((((,,((.(((.((((((((((,.{{...,}{(((((((...((.(((...((((((((.((..(({..,((,,,,}.))),))..)))))).))..))))).))))))))(((((((.(((.,(((.{..(((((((((.(((.((.(.((((((...)))))).).)).)))....((((((((((((.....))))).......((((((((.(((((((((((....))))).))))))...))))))))..(((((((((((((.((((.(((..((((((((((((((((((.((......)).))).))))))...),})))))))..))).)))))))).)...))))))))(((((,.,,...{|,.(((..((({.{(((((((.(((..(((((......))))).))).))))))).),)))})))...}}|(((((....)))))))))))}))))))(((((((..(,((((((.((((......))))...)))))).),.)))))))((((((.....)))))),|||,...,,,.))))))))).}.))).}..))))))))))((((((((((..,....(((((((((....))))}})))).,..))}}))))))),.))}}))))(((((((....))))))).............)))))).)))))).)))))(((((.............}))))))))))..)))))))))))).}}}.,.))))))..,,..)))},),.)))))))))))))))||...}))))))))))}))))))))).))))).((((..{((((((((((....))))))))))}..))))))))..)))..))))))|||||}|{{,||..(((((.((.((((......((((.....))))..))))..)).)))))..,.,))))))..)))))},...((((((((.........))))))))..{{.{{{{,,,)}}}})}.})))))))},..)))))}))))})))))))){|||{((((((.{(,..((((((..((.{(((...((((((,,,))).)))...)))).))..)))))),}}},))}))))}}}}|(((((((({..,,)}))}}}}))....,)))))))))))))).....)))))..))))))))..((((((((..,.(((.......))).,((((((({((.((((.(......}.))))..,)}.)))))))......))))))))..((((((((.(((((((.((((....)))}.(((({{{,..,{||||,,,,,,,,}}...}}},.)))).).}).)))))))).((((..(((......)))..)))).)))))))){((..{,...,}..},..,,,)))))))))))))}..))))))))))))).))))))))..}}}}||||.,.,,,|,.|(((,...))),..}}.}}}..}))..)))).))..)))).)))))))).)))}}))}(((.((((((((|..||(,({{{..,.,)))},}}{{((,{({..{||,|,,.,,}}}.)))..)))))))...,)))))))).))).)))))))).((((((((((((........,..)))))))).))))..(((((((...((((((.{(((.,.|}}}.,,,.....(((({(({{{.,{||||...}},{(.(((((..((((((.((((.((({(((..((((((((((,,.((((.,...((((((..((((((((.((.(((........))).)).))))))))...{(((((...))))))..(((((((....))))).)).{||......}},,....)))))).....))))..)))))))))).}))).))).(((.{(((.{(,.(((.....))).))))))..)))))))))))))...))))).))}}.)))))})))),.........}))))).)))))))......)))))..))))..)))))).))){(.,(((..(((.((((.{{.(({((...)))..((..(((.(.(((((..((((((((.((((((((((.(.(((....{.(((((..........((((((.......,((.((((......)))).)),((((((((((((.(((...)))))))))))).)))))))))...((((((....))))))))))).}..))).).))))).))))).))))))))..)))))))))..))...((((((((((((((({.(((((((...))))))).},,..((.((....}))).,}.{{{((|{{{,((((..,..({{((,|{,{((,,(((((({(,((((({{{{{||||||.|{||.(((((..((....))..)))))..(((((((({,,{.,{{||,||.,,,,|||||||.,,.{((((((...)))))).......||}}||,,|||...|,||}})|)))|))))...|})))}|}}..||||,|,..((((,..}}}}(((((((((({(,((({{(((.(((({{((((((((,(((((((((({{{.{{..{(((((,{,..({{(((.....(((((..(((,{.....})))..)))))..........{|.{{|(((((({.{({{{((,(({((({,{,.,.....,..|{|,|.,.{{.,{{{{|{{|.{((((((((((....(((....))){((.((((((((({.,.(((((....)))))..(.((((((....)))))).),.,.}))))))))))}}.......))))))))))},))))))))}.},,}..))))}))))),....,,|||||||{{|||,|||{({{{,,,||,,..(((((((...((((((((...))).))))).))}}))))..,,,}},..,.....,,.....})})))))}})))),))}..}))),....,))}}}},,|})}}))),},||.,,.{{{{{.,,,((,,..,({{{{{,((((..((((((....(((...)))....)))))),,},.,..,,,,)))))))))))))),}))))))))).....})))))}.,...................(((....}}}......{((((....(((((((........)))))))....))))}.,)))},,))..)))),.)}})......).))))))))))..||,|,||,.}}|))}|....,.)))))),)))))))}(((({.....)))))...,...|||,||.}},.}))))))}..,))).))))})).)))))))))))))...({{...}))..}}.)))))).))).)))..)}..)))))))).)))).....))))}.....(((...{(((((.(((((......))))).)))))}..)))....,.))))))))))..},,))),).)))))).))))...))))..))))))))))))))..)))))))))..)).)))))))))))))))).)))))))){(((({{(((...(((.((((((,(((({(.{{{......((((((.(.(((({,(((((.((((((((......))).)))))..............))))))))))).))))))((,({......}}}}..........,)).)).)))).)))))).)))...))),,,,)}||}},....,,,.((((....)))).(((((........)))))..((((....)))),)..))),)),)))))).)))..||{||,.(((((((((....,{{{({.,......||||||{,({,({{{{{,.,.||.,}},,,,...,{((,,,,,{,,,,.......{((((((,,.((((....)))),,.,}})))))||||,..,.......{{{|{{{{{{{,|{|{{.,,,.,,||||},,||||||}}|||(((((((((......)))))).))),,,..,,,}},}}|)),))))}}|.,.,,....|{|||...,,,))))}.))))))))),}))))))))))...}))).............

Transcripts

ID Sequence Length GC content
GAGUGUGGCUGCAGUGCGCCGGGACACCAGGGCUCCGCGCUCCGCACUC… 6446 nt 0.6184
Summary

This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. The C-terminal portion of the protein, known as canstatin, is an inhibitor of angiogenesis and tumor growth. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the COL4A2 was overexpressed in the ventral midbrain of the methamphetamine low drinking line and was identified as a hub node in the green coexpression module with connectivity differing by at least 0.5 between selectively bred lines [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human skin, analysis of thermally injured tissue showed that the COL4A2 was significantly up-regulated in burned tissue compared to normal skin, being categorized among collagen metabolism genes altered during the wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211].