Basic Information

Symbol
COL4A3
RNA class
mRNA
Alias
Collagen Type IV Alpha 3 Chain Collagen, Type IV, Alpha 3 (Goodpasture Antigen) Collagen Alpha-3(IV) Chain Tumstatin Collagen IV, Alpha-3 Polypeptide Goodpasture Antigen ATS3A ATS3B ATS2 ATS3 BFH2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_000091.5
Sequence length
8038.0 nt
GC content
0.4902

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2877.07 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.......))))))(((((((((((((..((((((((.((((((((((((...((((((..((((.((......)).(((((((.((((.((((..(((.(((((((.((......))..(((.(((((....))))).)))((....)).))))))).))).)))))))).(((((..((((..((((.(((((....)))))..))))..)))).))))).)))))))((((((((((((((((((..(((...(((((((..((((.(((((((((((((....(.((((((((((((..(((((((((((((......(((((((..(((...(((.((....)).))))))..)))))))...(((((....((((.....(((..((((((....))))))..))).....))))..))))))))))))......))))))..)))))))).((....)).)))).)..)))))...)))).)))).))))..)))))))..))).(((((.(((((...))))).).))))(((.((((((.(((((...(((((....((((((.........(((.(((((((((...((((((((...(((((((...))))))).((((((...(((((....)))))....))))))(((((....)))))((((((((((((....(((((((.(((.((((.(((((((...))))))).))))))).)))))))...)))))).))))))...((((((((..((((((....((((((((((.(....(((((.....)))))...).))).)).((..((((((.........))))))..)).......(((((.....((((((((((((((((((((((((((((((((.....((((((..(((((((.(((....((((.(((((.((.......(.((((.....)))).)((((((((((((((((((((((((((..(((........((.(((((.(((((.((((.......))))))))).))))).)))))..)))))))..((((((...........))))))(((((......(((.(((.(((((((.....((((.((((....((........))......)))).))))..((((.((....)))))).(((((....)))))..)))).))).))).))).....))))).(((((((.(((((.(.(((((((((.(((((....(((.(((((((((((..(((....))).)).))))))))))))...........(.((.......)).)((((.(......(((.((((((((....)))))))))))..).))))....))))).))))))))).).)))))..(((((((...(((..((((.........))))...)))...))))))).....)))))))))))))....))))))))))))).)))))))))))...))).))..)))))..))))))((((((((..(((((.((((((.....((((...((((..((.(((((((((((((..((((((.((((..........((((.......((((.(......).))))..((((((((((((((((((((((....((((((((((((((((((((.((((((((((...((((((..(((..((((((...((.......((((...))))(((.(((..((((((......))))))))))))(((((((((....)))...)))))).....(((((.((((((.((((((((....))))))))....((....))(((((((...(((...((..(((........)))..))..).)).)))))))(((((((.((((((.(((((((((.(((((((.(((...((.((((((((.....))))))..)).))...)))....))))).((((((((.((.......))))))))))...((((.....)))).......)).)))))))))(((((..((((....)))).))))).(((.((....)).))))))))).))))))))))))).))))))).))))))....)))..))))))...))).))))))).))))))))))))......))))))))..(((...(((((((.((((.....)))).))))))))))))))))((((..(((((((....)))))))))))......))))).))))))).))))((.....((((((.((((((.((.......)).))))))))))))....))..))))..))))...))))))...(((((((((((.((....)).))))))))))).......))))))))))))).))..))))...))))....((((((.(((((((....))))))).)))))).....))))))))).))...))).)))))..(((((....)))))(((.(((((.(.........).)))))..))).......((((((((((((.((((..(((((((...((((...((...........))...))))....))))).....((((((((.((..(((((((...(((((.((((.(((.((((.(((.(((((((.((.......)).))))))).))).))))))).))))....)))))...)))))))..........(((((((((.((.(..(((((((.....(((........))).....)))))))..).)).))))))))).)).)))))))))).)))))))))))).))))..(((((((..(((((((((....))))(((((((((((......(((((.....))..)))(((((((((.(((((((((.((.((....((((((((....((...(((((.((((..(((....(((((((.(((((...(((.(((((..((((((....).)))))...)))))...........(((((((...))))))).(((((....(((......((.(((...((....((((((((.((((((((((((.....))))))..)).))))(..((((((...((((.(....).))))...))))))..)((((((..((.((((.(((((((((((((((............)))))))))((((((.(((.(((((((((((.((((((((.....(((.(((...))).))).....))))).))).)))).)))....(((.....))).(((((.(((.......))).)).)))....))))))).)....)))))......((((...(((((..(((.(((.(((((((...(((.(((((((.(((((((((.((((..(((((((((((((((((.(((((..(((...((((.(((((((((...)).))))))).))))...)))......((((((((((.....))))))......))))..))))).)))))))))))))))))..))))(((..(..(((((((.((.(((..((..((((.((......(((((..(((....)))....)))))....)).)))).....(((((......)))))....))..))))).)))))))..)..)))..((((.((((((((((...))))))))))..))))((((((((...((((((.(((((((((((((.((....)).))....))))).......)))))).)))).))...))))))))...........((((......))))...))).)))))).)))))))..))).....))))))).))).)))..)))))...)))).(((((((((((.((.(((((...(((((....(((((((.(((((((...)))))))....((((((((((..((.((((.(((.(((.....))).))).))))..))..)))))).((((((.(..(((((((.((((..(.(((((((((.(((((((...(((..................)))...)))))))..)))))))))).))))..(((((.(((((..(((.((....)).)))..))))...).)))))..((((((.............(((((((..((((..(((...)))..))))(((..(((((....)))))..))))))))))((((.((((..(((((...(((((....))))).)))))..))))...))))..))))))......(((....))).....)))))))..).)))))).....((((.....((((((.....)))))).(..((..((((((..((.(((((((..(((((((.........(((((((((((((.....))))..(((..........)))...))))))))).........)))))))...)))).))).))..))))))..))..)..))))........((((((((...(((((((......))))))).....)))))))))))).)))))))....)))))(((....)))(((((.(((...................))))))))........((((((........)))))).....((((....))))...(((((.......)))))...))))).))..)))))))))))....))))))..)))).))..))))))((((((((.....))))))))...)))))))).....)).))))).......)))))))).)))...)))))...))))))))))...)))).)))))..))...))))))))..)).)).)))))...(((((..((.(((.(....))))))..))))).....)))))))))))))))))))...)))))(((((((((.......((((......((((...(((.(((....)))..)))...))))......)))))))))))))...........(((......))).......(((((((.(((.((.....)).))))))).)))................))))).))))))).((((((((((((.(((((.........(((((((...((((((((((((........))..))))))..).)))....))))))).))))))).)))))))))).........))))))))).(((.(((((......)))))))).)))))))))).((((((((((((((..((((((..(((((((((((.(((((((((........((((((((((.((....)).)))...))))))).((((.(((((................(((((.((((.(((.(((..((((((....)))))).))).)))))))..)))))...(((((........)))))(((((..((((..(((((..((((((((((...(((((...((((((((.(((..(((((.....))))).....)))........((((....)))).))))))))....)))))))))))))))))))).))))))).)).))))).))))...(((.(((((((.....))))))))))..))))))...))).)))))))))))..))))((((.((((...))))))))((((((.....((((..........)))).(((((((.((((.....))))))......))))).))))))......))..))))))))))))))..........(((((((.....(((((.((((.....)))).)).)))...)))))))(((((.....)))))........))))))))))...)))....)))))...........((((((((((((........))))))))....)))).((((....(((((((...((..............................((((((((.......((((.....))))..))))))))((((....))))....(((((..............)))))...))....)))))))....))))...((((......))))....)))))...))))))))))))))...(((((((((...............................)))))))))........((((((.(((((((..((......((((....)))).....))..)))))))...))))))...........))))))))...(((...(((((....(((((............................)))))...)))))..)))..............)))).))))).))))))))).....))))))))))..((((......))))(((((....((((.........((((.((((((...........)))))))))).........)))).......))))).........)))))).))))))))))........)))))))))))..((((((...((((.......))))...))))))(((........)))........((((....)))).))))..))))))((((....((((((((((.....))))))))))...)))).((((((.(((((.....((((((.(((((....(((((((.(((((((((........)))))))))))))))).((((........)))).(((((........))))).((((........))))......)))))))))))..))))).))))))...))))))))))))...........(((.(((((((((((((((((((...(((((((.............(((((((.....)))))))....))))...)))....)))))))(((((............((((((......)))))))))))................))))))).))))))))..)))))))).......(((((((((.(((......).)).)))).)))))..(((((((.((....((((((.......))))))..)))))))))...))))))).)))))).(((((((((((((.(((((.((((..((((....(((((.((((....(((.((.((((...((((................))))))))))))).....)))).)))))...))))..).))).))))).))))))..(((........))).....)))))))..........((((..(((((...(((((..((((((...((((((.(((...........))).)))))).........((((((((......((((((((....)))))))).((((((((....))))))))......(((((((...(((..........(((((......)))))..........))).......))))))).....((((((((((((....(((.(((((......((((((((((((((((((...(((((....))))).....(((.(((((......))))).)))........(((((((.((.((((((...))))))....)).)))))))........(((((.((((((.......(((((.......)))))......)))))).))))).)))))))...))))))))))).))))))))...........))))))))))))......((..(((((...)))))..)).........(((.((((((....)))))).)))))))))))...........((((.(((...))).))))......))))))..)))))........(((..((((((((....(((((......(((((((...((...(((((((((((((.((..((((((.....))))))...)).)))).))))))))).))))))))).....)))))....))))))))..))).......................)))))...)))).

Transcripts

ID Sequence Length GC content
GAGCUUUCCAGCCGGGCUCCCAGAGCCGCGCUGCGCAGGAGACGCGGUG… 8038 nt 0.4902
Summary

Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]

Forensic Context

A study in rats demonstrated that blast wave exposure induces vascular injury and upregulates the COL4A3 mRNA, with expression increasing in a blast intensity-dependent manner [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In mice selectively bred for differential methamphetamine consumption risk, the COL4A3 was identified as an extracellular matrix gene overexpressed in the ventral midbrain of the low-drinking line [Hitzemann et al. DOI:10.3390/brainsci9070155].