| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCUUUCCAGCCGGGCUCCCAGAGCCGCGCUGCGCAGGAGACGCGGUG… | 8038 nt | 0.4902 |
Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
A study in rats demonstrated that blast wave exposure induces vascular injury and upregulates the COL4A3 mRNA, with expression increasing in a blast intensity-dependent manner [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In mice selectively bred for differential methamphetamine consumption risk, the COL4A3 was identified as an extracellular matrix gene overexpressed in the ventral midbrain of the low-drinking line [Hitzemann et al. DOI:10.3390/brainsci9070155].