Basic Information

Symbol
COL4A4
RNA class
mRNA
Alias
Collagen Type IV Alpha 4 Chain CA44 Collagen Of Basement Membrane, Alpha-4 Chain Collagen, Type IV, Alpha 4 Collagen Alpha-4(IV) Chain Collagen IV, Alpha-4 Polypeptide ATS2 BFH1 BFH
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Other applications

MANE select

Transcript ID
NM_000092.5
Sequence length
9984.0 nt
GC content
0.4947

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3723.40 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((.(((((((((.....((((.(((((((.((..(((((.....(((((((((((...((((.((((((.(((((...(((.((.(((....))).)).))).)))....)).))))))))))...)))))))))))))))))))))))))))))..)))))(((((.......))))))))).))))((((((((((((((((((....(((.((((.......((((....))))...(((((.....)))))..((((...........(((((((((.((((((((...(((.(((((((((.....((((((.....))))))....))))..))))).)))...)))...)))))..)))).)))))....(((((((.....((((((...)))))).)))))))(((((((((((((.(((((((((((((((((....(((.(((.......((((...(((....)))(((((.(((((((....))))).)).)))))))))(((((....)))))(((((((((((.((......))))))))))))).......(((((((((((((((...((((((...(((((((((((((.....((((.((((..(((.(((((((.((((((...(((((((...........)))))))...)))))).(((((((((((.(.((...((((....(((((.(......).)))))..))))..))).)))..))))))))(((((((.(((.....(((((((((((.....)))).))))))).....(((((................(((((((...((((((......))))))((((((((((((((((((((.((((.((((.(((.....(((((((((((((((((((((((((.(((((((((.....(((((((....)))))))..)))))))))))))(((......)))(((((((......(((....)))((.(((((.....((((((((.(((((.....(((((((((.((..(((((((...((((..((((.((((....((((((.((.........)).))))))..))).)....)))).....))))..((((((..(((((((....)))..)))))))))).((...(((((....(((((.(((((((((((((....(((...(((((((......(((((..((((((.((((((.(((...(((((((((((((((((..........)))))))).........)))))))))(((((((.(((...))).)))))))...(((..((((.(....).))))..))).(((.((((((.....))))))..))).((((((((.(((...(((...((((((((((...))))))))))..)))...)))...((((((((.(.(((((....)))))...).))))))))(((...(((((((...(((((.((....)))))))..)))))))))).........((((((..(((((((....)))))))...(((((.(((((((((((......))).).))))))).)))))..((((((((....))))))))((((((....)))))).....(((..((((((.((..(((((...)))))...)).))))))..)))((((((....................)))))).)))))))))))))).((....))...............(((.(((.........))))))))).))).))))))))).))))))))))))...)))((((((((((((((.(((((....((((((((((((((.(((((((((((....((((..((..(..((((((((......(((((.(((((((.((((........))))))).))))(((((((((.......(..((.....))..)..(((((((((....(((....)))..............(((((((....((((...((....)).))))...))))))).(((((((....((((..(.(((((...........))))).)..))))...)))))))..))))))))))))))))))..((((..((((((.(((..(((((((.(((((.......).)))).)))))))..))).))))))..)))))))))))))))))..)..)).)))).....))))))))))).))))......))))))))))(((((((...(((.....(((((.(((((.......((((((..(((((((((((.((((..((((((((((((((...((((((..((((((....))))))..))))))((...(((((((((((((....)))))))..))))))...)).((((((((....((((..((.((((((..((((((....)))))))))))).))..).))).....)))))))).((((((......((.(((((((((.(((((((....)))))((((((.((.(((((((.....(((((((......(((((((.((((........)))).)))))))((((((((.....(((((((((((....((((.(((((....(((((...(((.(((((((((((.((((.((((....))))..)))))).)))))))))))).))))).....)))))...))))....(((((((.((((....))))))))))).....(((((((.....((((.......(((((.(((((((..((.((....)).))..))))))))))))))))....))))))).(((((.(((..........(((((((.........))))))).))).))))).)))))))))))...(((.(((..(((.(((((((((.((...)).))))))))))))..))).)))...(((((((((((..((..(((((....)))))..))..))))))))))))))))))).(((((..((((((((((((((((........((((...(((........)))...))))........)))))))))))).)))).)))))..)))))))))))))).))))))))...)).)))))....)))).)).....))))))..(((((((.((........)).))))))).....(((.....)))..)))))))))).(((((((.((........))))))))).(((((((.....(((..((((.(((..(...(((((..((((.(..(((........))).....(((((.(((((...((((((((((((..(...(((((.((.(((..(((((((...((((((((((.(((((.....)))))..))))))...))))...)))))))..))).)))))))....)..)))))))))))).((((((((((((.(((((........))))).....(((((.((((((.....(((....))).....)).)))))))))((((((((((..(((.(((((((((.(((((((...((((((...((((((.((.((..((((.((((.....)))).).)))..)))))))))).....))))))...))))))).))))))))))))))))))....))))((((((((.(((....)))))))))))..((((..(..(((.......)))..).)))).((((....))))))))))))))))((((....((((((..((((((.............))))))..))))))))))...(((((.(.(((((((..(((((..(((.((((((...((((.....((((((.(((((((((((((...((..(..((((((((((((((......(((((((((......(((((....)))))..)))))))))..((((((.(.(((........))).).)))))))))))).....(((((((....)))))))..((((((.(((((((.(((....((((..(((((((((((((....))))).).)))))))..))))((((((..(((((...((((....(((((....)))))))))(((((((((.((....(((((.(((((..((((((.(((((((((((....)))))))..))))..))))))((....))))))))))))....)).)).)))))))................)))))...))))))..(((((((((((((.((.((((((((....))..))))))))...))))).......(((((((((((((((...((((((..((......))..))))))))))))...)))))))))(((((((.((((....)))).))...))))).)))))))))))))))))).)))))).(.(((((.(((((.((((((((((((((((.(((((((..((((......))))...))))((.(((.((((((((..((((.((((.((.((((((((((((.((((.....((((.(((((((.((((...(((.....((.((..((((((..((.(((((((...((((.((((((((.((.((((((....))))))..))((((...))))..))))))))...)))))))))))))))))))..)).))...))).)).)).)))))))))))..(((((...))))).(((.(((.((((..(((((((((((..((.(((((((((((((((.(((....))).....((((((((((......))))))))))......(((.......))).)))))))(((.....))).......)))))))))).)))))))))))........)))).)))...)))..))))...))))))))))))...........((((....)))))).))))))))....(((((..(((((((.((.((((((((((.(((.((((.(((((.((((.(((...(((.((.((((.(((.((...((((.(((.(((((((....)))((.((((((........)))))).))..))))..))).))))...)).))))))).)).)))..))))))).....((((((((((....))))).))))).))))).))))...))).)))))((((((...))))))......))))).))..)))))))..)))))((((....))))..(((....))).)))))))).))).))(((((((((((.(((............(((.....)))........(((((((((((.((.((.(((((.....((........))....)))))))..)).)))).............((((((((......)))))))))))).)))..))).)))).)))))))......))).)))).....))))))))))))))))).))))).)))))))))..).))..)))))))....)))))).))))))...))))...))).))).))).)))))..)))))))).))))).(((((((.(((.....((((((((((((..((((.((((...............)))).))))..))..(((...((.....))...)))...........................))))))))))..))).)))))))....((((...((((((((......(((((...(((((((((((.....((((((.(((.............(((.....)))...((((..((((((....(((...........)))....))))))..))))((((((((((..((((.....(((((...))))).....)))).(((.(((((((((........))))))))).)))...((((((.(((...((.((((((...))))))..))....))).))))))...(((........)))...........((((.......))))...........(((.((((((((....)))))))))))..(((((((((((((....((...((((......))))...)))))))))))).)))..)))))))))).....))).))))))..))))))))))).....)))))(((((((..........)))))))...))))))))....))))..)))))..)))))...(((((((...((((....))))...)))).)))..((((((((((.((((..((((..(((.(((......)))))))))))))).)))))))))).........).)))).))))))..))).))))..))).....)))))))..........(((.(.(((((((((.((..((((((((.(((((.(((......)))...))))).))))))))....)))))).....)))))))))................((((((.(.((((((((((((((((((....((..((((((((((.((((...........(((((((((((((((((.....))))))..(((((((.((((.......)))).))))))).......((((((.....((((...)))).............((((((...)))))).............))))))((((......)))).......(((((((.((((((.......((((..(.((((((..((.......(((((.(((((((((........(((((...(((((.....(((((((.......(((((........))))))))))))...))))))))))........))))))))).))))).......))..)))))).)..)))).....)))))).))))))))).))))))))).)))).........((((((((........))))))))..................))))))))))))...)))))))))))).)))))))))))))..(((((((.((((...)))).)))))))...))))))))))))))))))............((((((.....(((((((((...(((((.((..........((((((((((((......)).))))))))))............)).)))))....)))))...)))))))))))..)))))).......))))))))))...))))))))))...........((((((...(((((((((.(((((((....(((((...........))))).....(((....((((((((..........)))))))).....))).........))))))).)).)))))))))))))(((.((((....(((((..(((((((((..((((((.....((((..(((..((((.........))))..)))))))....)))))).......................)).))))).))..))))).....(((..((((((((.(((...(((((((((.(((..((((...((((((.(((((...((((....)))).)))))))))))))))(((((((...(((((..((((...))))..)))))....)))))))........(((((......)))))...))).)))))).....................(((.((((....)))))))........))).))).))))))))..)))(((((..(((....)))))))).......(((....))).)))).)))........)))))))).)))))))))))....(((((...(((..(((((((.((((((((.((...(((((.((...........)).)))))...)).))))))))))).)))).))))))))((((...)))).(((((((((((((((((...((((((...)).)))))))))))).......)))))))))............((((.((((((((....)))..))))).)))).....))))).))).))))))))))..)))).)...)))))))))..)))))).))))).......(((((((........)))))))..........))))).))))).)))....))))))).....((((...))))...))))))).....))))))))).)))))....(((((((((((.....))))))..)))))....)))))))))).))).).))))..)))))))))))....)).)))))))....)))))))(((.((((....)))).))))))))))).)))))))......((....))..))))))).........(((((((..((((((((((.....)).))))))))))))))))))..))))..))))))))))))))))).((((...))))))))))))))))....))).)))))).(((((......)))))...))).)))))))))))))....((((......))))((((.....))))))))))))))....(((.(((((((((.(((..(((((.....(((((((((((((.(((.((((((((((((......)))))................))).)))).)))))))))))))))).......(((((((.(((((((((.((((((((((((..................((((((....))))))...))))))))).))).......)))))...........((......))....((((((((((.......)))))))))).....(((((((.....(((((((...(((((......)))))...)))))))....)))).)))......)))))))))))....(((((((.((((((........(((.(((((((((((((((....(((((((...(((((((..(((((.........)))))(((((........)))))..((((((.(((....((.....))....))).)))))).....)))))))...)))).....))).....))))))))))))))))))........((((..((((((((..........((((........))))........))))))))..))))....))))))))))))).))))))))))))))))))))(((((...((((.((.(((((((((((..(((((((.((((((..((((...))))..)))))).......)))))))..)....))))))))))..)))))).)))))...........((((((........((.......))............(((((((.....)))))))...))))))((((((.......))))))....(((((((((...........)))))))))..))))))))))......((((.....((((((((.....((((.......))))....)))))))).....))))))))(((((((((...))))))))).)))).....))).....)))))))..))))(((((..(((((.(((...(((((((((((.((.(((....))))))))))))))))..((((..(((((........(((....)))....))))).))))......(((.(((...))))))....((((((((.........(((.....))).........)))))))).))))))))...)))))...((((.((((((.((((((((((.((((((..(((.....)))..))))))...)))))).........((((.((((((...))))))))))..((((...))))(((.(((((((....)))..)))))))........((((((........)))))))))).)))))).))))....)))))))..............

Transcripts

ID Sequence Length GC content
ACUCGGGAGGCCCCGCUUGUUCCCCGCGCCCGCGGCGGUCCGCGUUCCC… 9984 nt 0.4947
Summary

This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice selectively bred for high or low methamphetamine intake identified the COL4A4 as an extracellular matrix gene overexpressed in the ventral midbrain of the low-drinking line, indicating its role in the transcriptomic basis of differential addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155]. A study in rats demonstrated that the COL4A4 is widely studied in the context of fibrous scar tissue formation following spinal cord injury [Bighinati et al. DOI:10.3390/ijms22041744].