Basic Information

Symbol
COL5A2
RNA class
mRNA
Alias
Collagen Type V Alpha 2 Chain Collagen Alpha-2(V) Chain AB Collagen Collagen, Fetal Membrane, A Polypeptide Type V Preprocollagen Alpha 2 Chain Collagen, Type V, Alpha 2 EDSCL2 EDSC
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000393.5
Sequence length
6829.0 nt
GC content
0.4829

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2475.80 kcal/mol
Thermodynamic ensemble
Free energy: -2596.32 kcal/mol
Frequency: 0.0000
Diversity: 1730.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((....((((((.((..((((..((((((...((((..(((((..((((((.((((((((...(((((((.....)))..)))).))))))))......))))))........((((.(.(((((......((((((((((((...))))))))).)))....))))).)))))....(((..(((((((((((...(((((.((.((((..(((((....))))).))))..))..)))))))))))).))))...))).......)))))))))..(((.....((((((((.(((....))).))))))))....))))))))).))))..))((((.(((((((((((.(((((..(((((......)))))(((((((((.((.(((((..((((((.((((((.......(((((((......((((((((.((((.....((((....)))).(..(((((....)))))..).................(((..((((.(....((((((((....)))))))).).))))..))).)))).)))))))))))))))...)))))).((..((((...((((((((((...((....))))))))))))...))))..)).......((...((((((....))))))...))))))))))))).)).)))))).))).(((((.((((((...((((((((((....))))))))............)))))))).))))).......((((((((((((((((((((((((.((((.((...((((((.((((.(((...))).))))))))))(((((((.((((........((((.(((((.(..(((((((....)))...))))..).))))).))))..((((((..(((((((....))))))).)))))))))).))))))).(((((((((((((.((((((.(((..((.((((((((......)))))))).))......((((((((((..((....))..))))))))))))).))))))((..((((((....(((((......)))))...))))))..)).......((((((.....))))))(((((((((((((.((((.((((((....)).))))))))((((((.(...).))))))((((...(((((((((((((..(((((.((((((((((.(((.(....).))).)))).((((((.((.(((......(((((....)))))))).)).)))))).((((((((....(((((((....)))))))....))))).)))(((.(((.(((((.(....).))))).))).)))..(((((.(((((....(((((((((....)))))))))..)))))(((...((((((......))))))))).(((((((...)))))))..((((...((((((((...((((((.((((..(((((((.(((.(..((((((..((((.(((((((((...((......))))))))..))).)))))))))).....).))).)))))))..))))(((((......)))))((((((....((....)).))))))...)))))).))))))))...))))(((...))).(.((((((....((((..(((..(((((..(((((((((.((((((...((((((...........((((.((((((((.......(((((((.((((((..((((((....))))))..))).)))...))))))).((((((((.((...)).)))))))).......)))))))).)))).(((.(((((((....))))))).))).(.(((((.(((.((..((((((.((((((((((((((((((..(((.....)))))))).))))..)))))))))......((((((((..((.((((.(((.((((((((.(((((((((.(((((......))))).(((((((.((((..(((.((....)).))).))))...))))))).((((.....))))(((((((((........)))))))))....................).)))))))))))))))))))((((((......)))))).....)))).))..)))).....))))((((...(((((((((((..(((((....)))))))).))))))))..))))...(((..(....)..))).))))))..)).))).))))).)))))))...))))))....(((((.((.((((.((.(((((....(((((..((((.(((..((...(((((.(((.........(((.((.((((((((((.((((((.(((.....))).)).)))).))))((((....((((......))))....)))))))))).)).)))))))))))....))..))).))))..)))))..)))))(((((((..(((((.((((.(((((.....(((((...)))))((..(((((((..((....((((((((((((((.((((((((((.....))))))).))).))...)))))((((((((((((((.(....).)))))).((((.(((((((((.(((((((((....((((((((((((((......((((((((.......))))))))......)))((((((((((.(((((..((((((((((..(((((.((((((((((((((.((........).).)))))))))).((((((..(((.....((((....))))..)))..))))))...(((.((((((.(((((.....))))).))))))))))))).)))))..))))..(((.(((((((((((((((((.....(((((.((((((......)))))).)))))..)))))))))))(((.((....)).))).))))))..))))))))).))))).))))))))))((((((((....)))))))).)))))))))))...)))))(((((....)))))........)))).))))))).....)).))))(((((((((.(((((.....)).))).)))))....)))).....(((((.((((.(((((((((.................))))))))).(((((...)))))....((((...(((((.....((((((((.((((((((.((((((((...((((((((.(((((..(((((((....)))))))..)))))....((((.(((((((((....))))))............))).)))).(..((((..((((((....((((((.(((((.((.((.(...((((((((((((((...((((((.((.(((((...)))))))...)))))))))))))))...)))))...).)).))))..........))).))))))(((((((....))))).))...((((((((((...(((((......((((((((..((...((((..((......((.((((.((((.(((........((((((((.((((((.....)))))).)))).))))((((((.....))))))(((((((....((((((((.((((((((((((....(((((((((.((((((((((.((....)).(((((((....((((((.......))))))....))))))).)))))))))).)))...))))))....((((((((((((((.(..((.(((((((((((((.....((((.((...)).)))).)))))).))))))).....))..))))))).)))).))))....((((((((....))))))))........))))...))))))))..))))))))..)))))))))))))))))).)).....))..)))).))..)))))))).(((((..(((......))))))))..........))))).....)))....)))))))...))))))...))))..)((......)).....(((((((......)))))))...(((((..(((((((((.((((((.....))))))(((((((..((((............))))(((((.............)))))..))))))).....)))))))))))))).........)))))))).....))))))))..........((.(((((..((((((.((((((((.(((...))).)))))..))).))))))))))).)).......((((((((((((((..(.(((.(((((.(((((..........(((......(..(((..((((((.((((....))))))))))....)))..)......))).((((((.((.......)).)))))).))))).))))).((((((((((((((((.((((.((.(((((.......))))).)).))))........((((......((((..(((....(((((((((..((((.......................))))..)))))))))(((.(((..(((((.(((.(((((((((.(((((((..(.(((((.(((.(.......).)))))))).)))))))).......))))....))))).)))..))))).....))).))).)))))))......))))..)))))).)))))).))))......))).)..))).)))))))))))....))))))))...........))))))))....)))))..))))..........................)))))))))........(((((((((...(((((((((((......(((..((((......))))...)))............(((((.(((((((..(((((((.((((........))))..)))))))..(((((......)))))(((((((((.((......(((((...)))))......))))))))))).....((((...........)))).............)))))))..)))))))))))))))))))))))))))))))))..)))))))....))((((((.((..(((((...((((((.....(((..((.....((((((((..........))))))))...))..)))........))))))))))).)).)))))).............)))))))..))(((((((.((((....((((((.(((((((((.((((.......((((((..(((((....))))).((..((((((((((.((..((((((((......)))...)))))..))...)))))).))))..)).))))))...((((...(((((((....))))))).))))))))))))))))).))))))..((((((...((((((....))))))....))))))..........(((((((..............))))))).......))))..))))))))))))...))))...))))).)))))))..((((((((((..((...............))..))))))).)))...((((((((.......)))))))).(((((((((((....(((((..(((.((((((((((((......)))))...(((((.(((.((((((..(((((((((.(((((((.....))))))).)).....)))))))...)))..)))))))))))((((((....(((((....)))))...))))))........((((((((((((........)))))))))))).......))))))).)))....))))).....)))))))))))((((.......)))).((((....)))).)).)))))))))))....(((.((((((.......)))))).))))))))))))..))))).))).))))....)))))).).....(((((((.((((......)))))))))))))))))))))).)))))..)))))))))))))....))))..((((....((((((((..........))))))))..))))(((((...)))))......((((((((((((((....(((....((((((..((((((((..((((((...(((.((....))..)))...)))))).))))))))............((((((((...(((.(((((((......))))))).)))))))))))((((.((...)).))))..((((.........)))).))))))...)))...)))))))).))))))....((((((((((((..................(((((...(((.........))).))))).(((((((.....((((((.(......).))))))..)))))))....))))).)))))))........((((........((((.(((((((.............)))))))..))))........))))))))))))))))).................)))))))))))))...((.(((((.....))))).)).........(((((.((((....)))).))))).)).)))).))))))))))))))))))))))))..................((((((....)))))).........)))))....)))))..)))))).))))...(((..(((((.((.((((.......)))))).)))))..))).....))).))).....)).))))........
Thermodynamic Ensemble Prediction
,,,...,,|,{(((,((.(({.((,,...{{((((({{{{..,|||||}}||((((((((,(((........)))}}.}}|||{,{{{{,{{(({|,......,}},,,|,..,...,{{{{.(,({{{{,,,...((((((((((({...})))))))).)))....}}|||,}}},,...,{{{,.(((((((((((.,{{((((.{(.((((..{((({....))))).))))..,)}})))),))))))),,)))...})),,,}...,,))}}|}},.|||..,{,((((((((.(((....})).))))))))..,,}.}))))||{||||{,....||,|,|})))|{(({{|{(({{(,((({{{..{||||,{((((((((.((.(((((..((((({.((((((.......(((((((......((((((((.((((.....((((....)))).{..(((((....)))))..}........,,,,.....(((..((((.(....((((((((....)))))))).).))))..))).)))).)))))))))))))))...)))))).((..((((...((((((((({..,((....))))))))))))...))))..)).......((...((((((....))))))...))})))))))))).)).)))))).))}.(((((.({((({,.,,.((((((({....}))))))).,,,|||,...,)))))))).))))).......((((((((((((((((((((((((.((((.{(,,,(({((((((({.{{|,,,))},)))})))}}|(((((((.((((........((((.(((((.{..(((((((....)))...))))..}.))))).))))..((((((..(((((((....))))))).)))))))))).))))))),(((((((((((((.((((((.(((..((.((((((((......}))))))).))......((((((((((..((....))..))))))))))))).))))))((..((((((..({(((((......))))))..))))))..)){{{{,.,((((((.....))))))(((((((((((({.((((.((((((....)).))))))))(((((((((((({{.(((..(((((((({.{,{((((((,{(((((((.,...((((.(((.(....).))).)))).{(((((.((.(((......(((((....)))))))).)).)))))).((((((((....(((((((....)))))))....)))))},))(((.(((.(((((.(....).))))).))).))),.{{{||.(((((.,..(((((((((....))))))))),.)))))|||}}}}||||(,..,..}}}}},}},.{((((({...))))))}..}||}}},.}},)))))}.{((((((((..((((.(((((((.{.(((((((((((((((((..(((((((..,.,..,.,(((.((((.{,....}}))))))}((((((({,.{{.,({{{.(({{(((((......)))))|(((((....((....)).))))),..})).}))).||||({....))))))))))))......,}}....)))))))..)))))...))))))......)))))).}.))))))).))))...)))))))))))))))).{(.((({(((((,{{((((....((((.((((((({.....}.)))),,)).)))).((((((((.{(...}}.))))))))...||,,))).|)))}}.))},||.(((((((....)))))))..((((.(((((,(((,((..((((({.{(((((((({((((((((..{((.....))})))))))})}..))))))))}.....,(((({{{{,,((,((((.(((.(((((((,,(((((((((.(((((......))))).{((((((.((((..(((.((....)).))).))))...))))))).((((.....))))(((((((((........)))))))))....................)})))))))))))))))))))((((((......)))))).....))}}.}}..))))},,,.))))(({{...{{{{{{{||||.,{{{{{..,,))}))))}.)))))))}..})))...|||..|...,)..})}.})))))..)).))).))))).))))))).)}.)))))))))))}{{((((((...,(((((((....(((((..((((.(((..((...(((((.(((.........(((.((.((((((((((.((((((.(((.....))).)),}))).))))((((....((((......))))....)))))))))).)).)))))))))))....))..))).))))..)))))..)))),,))|{((((((((((((((((((((((((((((.((,,((((({,((((({.,({{,,,...,,,{|||||||}}({(|{{((((((..{{{{{||{||.||..,}}.}}))).....((((.{..((((((((((((.((((((((((((,{{(,{.,,{{(((|...,}}}}}....},))),......)))))))))))).)},,{((({..,,,}}}}}((((((((((.(((((..(((((((({,..((({{.{|||((((((((((.({........}.).)))))))))).((((((..(((.....((((....)))),,)))..))))))...(((.((((((.(((((.....))))).)))))))))}}}|,}}|||,.,}},.||||..,{|||{((((((((((.....(((((.((((((......)))))).)))))..)))))))))))(({.(({...})|})).}|}}})}.})))))))).))))).))))))))))((((((({....}))))))).,)))))))))).}.)))).)))}}.)))))))).}}}.,((((({(((({{,,..,,||||{..{(((((((((.((({({....)).))).))))}...})))))...,((((((({((.(((((((((...{........}....))))))))).(((((...)))))..,,((((...(((((.....((((((((.((((((((.((((((((...((((({((,(((((..(((((((....)))))))..)))))...,||||.{||{(((((....)))))){,,,,{......,}}.||||{({.((((.{((((((.{{.(((,{({{(({,.{(,(((..((((((((((((((....))}}))))}}.}))))).|}((((.{.((((((((((...)))....))))))).).))))......,,|,,,,|||.||||||(((((((....))}}}.}},,.{{{{||||||...|{|||,}}.},|(((((((..((.,,{(((..((......((.((((.((((.(((......,.({((((((.((((((...,,||||}}.}})),)))){{||||,,..,))))))(((((((....,(((((((.((((((((((((.,,.(((((((((.((((((((((.((....)).(((((((..,,((((((.......))))))..,,))))))).)))))))))).)))...)))))).,..((((((((((((((.,.,({,(((((((((((((.....((((.((...)).)))).))))))},))))))..})..,..})))))},)))).))))....((((((((....))))))))........))))...))))))))..))))))),..)))))))))))))))))).)).....))..)))).}),.))))))),.{{{{|.|{({......}}})}}},.....,},..)))))....,)),},..}}))),),..)))))),}.))))..,{,,,....}).....(((((((......)))))))...(((((,.{((((((((.((((((.....))))))(((((((({((((......{(({.({,|....,{....},}.,}},,}.)))))))))))).....))))))))))))))......}},))}))))),,}..))))))))..........{(.(((({.,((((((.((((((((.(((...))).)))))..))).))))))))))).)}.......(((((((((((((({.{.,{,.(((((.(((((........,,{{{...,,,,..{((,.((((((.((((....))))))))))....,)),.,......}}}.((((((.((.......)).)))))).})))).))))}.{{(((((({(((((((.{{{{{((,,{,,,...,,}},}}},.}},||||{{((({{{(((((({...|{{,..,,{...,{{|||||||..||||}}}}}....,}},}...,.,{{.||||..,,))))))}|,,.,.|.,||||{.(((((({,,(((({(,,,,{,....,...|,((((((((...(((((|||,{{(((,(({((.......,,},..)))))..})))}}).)).)))...)))))).)).)))))))))})}.},.}}}})}.}))))))}))),.,...}}).,}}})),}))))))))))....))))))))...........))))))))....)))))..}})}........,{{{,....,.,,,....|}|}}}}}}.,{,,.,.{{{((((({...(((((((((((....,{({{{,((((......))))..,|,,......,,.{,{({{{{.{{{|||||,|((({{{.{{{{........}})),,)))}}}}..(((((......)))}}{((((((((.((......(((((,..,,)))}}}...))))))))))).,,{,(((({{{.......,}|||,,,.,.,||||,,|||}|}},,}})}})}}))})))))}}}}))}))},,}}|}}|}||}},}}},}}}}},|,,(((((((((...,{(((((,,,...,||.}||}}||.((((((((..........)))))))){{{{{{....,}}}}},{||||||{{,.,{||||,})}}.............,|,||}}}.,,.((((((((((({...((((((.(((((((((.((((.,.....((((({..{((({....})))}.((..((((((((((.((..((((((((......)))...)))))..))...)))))))}}))..)).})))))...{(((...(((((((....))))))).))))))))))))))))).))))))....,,,.....|||||}}}}))))}}....}))}}}.....))))))))|,,,.,............{{{{(|..{(((.(((......))).,,)))..})))))....,}}|}}}|}.}}),||{{{{{{{|,,||,....,.,,...,,,)),.))))))).}||{,.((((((((.......)))))))).||||{{(((((..{{(,(((..,,|}|,|||,,|||||..,,..))})),,,{({((|{({.{{||{{,.(((((((((.(((((((.....))))))}.))|,...,}})))),,.})).}))))))}}||}{(((({.,{.{((((....)))))}}}))))))},......((((((((((((........)))))))))))).......}))))}}.,,.,},.,.,,,.....}}|||||}}},|{{{.,.,,,,||},.,,||....})}}||,,,}},,}}}}}},...|{,,((((({...,,{,||||}}.|}}||.|}}}},},}}.,.,,.}}}}.}))})))}},},,...,{{((((((.((((......))))))))))))))))))))))))))).)))))))))))))),...{{{{{{{{{{((((.((((((((..........))))))))...))){((((...))))}....,,,||||||||{{,,,....{{||..||||,...}))),,}}},,,,,....)))).))))))))))}}(((((.((..(((........)))..)).}))))((((((...(((.(((((((......))))))).)))))))))(((((((((((((...{.(((.((({{...{{.(((({{{((({.....)))).})),)})},}.,.,,,,..{{((((((((({..................(((((...(({........,)}}.))))).(((((((.....((((({,{,....,).))))))..))))))).,..}))))}}}}})}}...,}},....,}}}.......}}}}}.|}},,.))))))))))))).,,,,.......}},..,))))}}))))))))))))..........,}}}}..)))))))))))))...((.(((((.....))))).))....,.......,|,(((({{{.,,,,.)))))}),.)))).)))))))))))))))))))))))).,{((((..,.,.,,...{{((((....}))}}}......,.})))))....)))))..))))))..,,....{((..(((((.,,.((((.......)))),}.)))))..)))|}},})}}.))}.....,))),)))))).,,.

Transcripts

ID Sequence Length GC content
GCAGACUGUGCUGGAGCUGGUGCUGAAAAAGGGGGUUUGCAGAGGCUGC… 6829 nt 0.4829
Summary

This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the COL5A2 is upregulated (1.5-fold) in right ventricular tissue during monocrotaline-induced pulmonary arterial hypertension and failure, indicating its association with fibrotic pathways [Potus et al. DOI:10.3390/ijms19092730]. In human corpus cavernosum tissue, single-cell transcriptomic analysis identified the COL5A2 as a marker upregulated in an endothelial subcluster undergoing endothelial-mesenchymal transition in patients with organic erectile dysfunction [Zhao et al. DOI:10.1038/s41467-022-31950-9].