Basic Information

Symbol
COL5A3
RNA class
mRNA
Alias
Collagen Type V Alpha 3 Chain Collagen Alpha-3(V) Chain Collagen, Type V, Alpha 3 Pro-(Alpha)3(V) Collagen Collagen Type V Alpha 3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_015719.4
Sequence length
6207.0 nt
GC content
0.6422

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3008.80 kcal/mol
Thermodynamic ensemble
Free energy: -3109.35 kcal/mol
Frequency: 0.0000
Diversity: 1655.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((..((((((((((.((.(((((.((((((.((((((....((....))...))))))))))....)).))))).))....(((((((((.....(((((((...))).)))).)))))))))((((((((((((.((((..(((((((.((((..((((..((((((((.(((....((((.(((((((...((.((((.(((((.((((.(((((.......(((((.(.(((((..((((((((((((...)))....))))))))))))))))))))))))))))).)))))....((.((........)).)).)))).))...)))))))((((.....)))).(((((((((...((((.(((((((..(..((((((((((((((...(((.(.((((.(..((..((..(((((((((((((((((((............(((((.(((((((.(((((.(((......))).))))))))))))))))).......((((((((((..(((((((.....((((.(((..(....)..)))))))(((((.(.((((((......)))))).).)))))(((((((((.(((((((....)).)))))((((((....(((....((((((.((((((((.((......(((.((((((((((((((((((((....)))))((((....))))..(((......((((......))))....)))...)))))))((((((..(((((.((((..(((((.(......)))))).)))))))))....)))))))))))))).)))((((((((..(((....((((((..(((((((.(((((.(..(((.....(((((.(((..((((..((((....(((((((((.(((..........((((....(((((.....)))))..))))..(((....))).......))))).))....)))))........))))...))))....))).)))))...)))..).))))).)))(((((.......)))))..((((..((........))..)))).))))(((((((..((.......))..)))))))(((((((((((((.((..(((.((((((((((((......((((.(((.(((...((((((((........))))..........))))...))).))).))))..))))))))))))((((((((((..((.((.(((((((.(((.(((..(((((....((((.....((((..((((((..((((.((((..(((((....(((((((..((((.....))))..))..)))))(((((....))))).......)))))...))))))))..))..))))..))))))))((((((.....((((..((((((...)))).))..))))..))))))....)))))))).)))..)))))))....)).))....))))..))))))..)))..))))).(((..((((((..(...(((..((((((.....(((((......((((.(.(((((((((.((((......)))).))))))))).).)))).....)))))....))))))))))..))))))..))).))))))))))..((((....(((.((....)).)))...))))))).))).....)))..)))))))).)).))))))))..))))))))))))))).....((((((.(((((.((((.((((.....))))..((((((..((((((.......((((((((......)))))))).....(((..((((..(((((((((((...........((((((((...(((..((((((((((....))))...)))))).(((((((((....)))))...)))))))....))))))))(((((...))))).(((.(.(((..(((((.....((((.(((((((((((...))))...........))))))).)))).....))))).))).).)))...(((((((((((.((((((....))))))..)))))))).)))..))))))))).)).)))))))(((((....)))))....))))))..))))))...)))).)))))(((((...))))).......(((((((............))))))).)))))))))))))))((..(((((...)))))..))((((((((((.(..(((((....)))))..)..))))))..)))))))))))...)))).))))))......(((((((.((((((((..(((.(((.((((((((...(((..((....)).)))..)))))))).))))))..))))........)))).)))))))...))))).))))))))))))))...))..))))))))))).))))).)))))))))..)..((((((....)))))).(((((((...((((((....)))))))))..)))).......((((((((..(((((((.......)))).).))..)))))))))))))))...((....)).))))))))))))).(((((((((....)))))))))........(((((....((.((((....)))).))..)))))..))))...)))))))))))((((((((..((((..((((((.....((((((..(......)..))))))))))))..)))).(((((....)))))((((((((.((............)).))))))))...(((........)))......)))).)))))))).)))).))))))))))).)))).....))))).))).)))))))...((((((.(....(((((.....(((....(((((((....)))))))....)))(((((((..((...(((((((......)))))))....((((((((((((((...((((.....))))..))))))))(..((((((.(((((.((..(((((((...(((((((((((...((((((((((((.((((((.(((..(.((((...)))).)..))).))).((((((((.(.((((((((....((((((.((.((.(.....(((((..(((..(((((.(.((.(((.(((((((.(((...)))))).))))...))).)).)))))).)))..)))))).))))))))))....))))))))).)))))...))).......))).)))))))))))))))))))...)))).)))))))..))))))).))))))..).....((((((....(.(((..(((((((((((........)))).))..(((((..(((((((((((((.(((((((((....))))).....(((((((....)))).))).(((((((((........))))(((((((((.((((((....))).))).)))))))))((((((((..........(((((((....(((((((((..((((.((((((.....))))))..))))((((((((..........)))).)))).(((((.(.((((((((((....))))))).))).).)).)))((((((((...((((.....(((((((.(((((.(((((.(((((((((.((((..(((......(((((((.(((((.(((((((.(((((.(((.((((((.(.(((.(((((.((.((((((...))).))).)))))))..)))...).))))))...((((((((((((..((....))..)))((((....))))........)))))))))((((((((.((((.((..(((.(.(((((......((((((((((.........))))..(((((....)))))((((((((((.....(((((((((((.(....((((...)))).....).))))))))))).....))))))))))..(((((.((((((.....)))))).)))))(((.(.((((((((((.((((.....))))..))))).....((((((.....(((((((((((((((((((((((....)).((((((((.((((((.(((((..(((((((....)))))))))))).)))((((((.(.(((((((...)))))))).))))))(((((((..(((((...)))))(((((.(((..((((.((((((((((((((((((((((((...((..(((((.........))))).))..)))))).))))))....((((((.((.(((((....))))).)))))))).))))))....((((.(((.((((.(((((((((..((((((.((...((((((....)))))).......)))))))).))))))))))).))..))).))))((((((((((....))))).)))))))))))))).)..)))...)))))....((((.(((((((.((.((((((((.(((....))).)).......))))))...))..))))))).))))..((((((((((.(.((((.((..((.(((((((((((.(((.((..(((((((((....)))).))))).))))).))))))))))))).(((((......))))).)).)))).).)))))).))))((((....)).))(((((.((((.((((((....).))).)).)).)).)))))..))))))).))).))))..))))....((((.(((....)))))))((((((((((((((((((((((.((((((....((((((....(((((..((((......)))).)))))....)))))).)))))).))).((((((((((.(((..........))).)))))))))).........((((.((((((((....))).))).)))))).....)))))))))........).)))))))))........((((.(((.(((((......))))).)))...)))).......((((......))))..))))))))((......)).((((((.............)))))))))))))))))))..(((.((((.((((((..((.....)).)))))).((((..(((((.((((....))))((((((((..(((.(...((.((((((((((...))))))(((((.((((.....)))).))))))))).))...).)))..)))))))).)))))..))))(((((.........)))))((((((....((((((((.((((....)))).)).).).))))((((.(((((((.....((((((((....((((((((((.....(((((.(.((((....)))).).)))))....((..((((.((....((((.....((((.((((((((..........)).)))))))))).))))..))))))..)).((((((((((...((((......))))))))))))))...))))))))))((((..(((...)))..))))))))))))..))))))).))))...))))))...)))).)))))))))..)))))).))).((.(((((........))))).)).......)))))))))))))))..)).)).)))))))..)))))).)))))))))))).)))))..)))))))))).)))))))).))..))).)))))))))).)))))))..)))))))))))))))))))))..)))))))))))))))....((.((((......)))).))..)))))...((((((((.....))))))))...)))))))))))))))))..)))))..)))))..))).)...)))))))))))).(((((((.((((((((((.(((((.((...)).)))))))))))))).......).)))))))))..))))))).(((..((((((.((((...........))))..))))))..)))....))))))))))))((((((...))))))....)))...)))))(((((((((.(......).)))))))))...(((((((........)))))))(((((..(((........(((((....)))))........)))..)))))
Thermodynamic Ensemble Prediction
...{({{{{{(({((((({{((({(((({.((((((.((((((.,..((....})...)))))))))),,,,||{||}||((((.,{(((((((((.....(({((((...)))},))).}))))))))).)))).....((((((..((((((.{....}.))))))..))))))||}}}}}.||..,,)),)))).|||||||{,,{((((((({,(((((,,.{{.(((((({((.{{(((.(((((((((((((((((,({(((((((((.((((...({..((((((.(((.(..((.....((((,,(((.....((((..((((((((((((((..(((...(((((....,,,,{{{{{,(({{,,,,{{{{(,{{...{{{{{(((({,.{({(({.{{||{((((({{,(,{,....|,})),|||))}||||......}}},..|||((.(((((((.{(({(,((({,,...}||,||}}}}}}|||||}|||,,||,,((((((.((((.(((((((((((.(((.....((((((.(((.((((((((((((.(.((((((......)))))).).)))))}(((((((.{((({((({{{{||,|},||((((.(((((((({{..{{|....))),,.{((((((((.((....))))))))))})).))))))))...))))....,..||||,,{{|,,....||.((,((({{{{...}}},,.|},,})}.(((((((..(((((.((((..(((((.{......}))))).)))))))))....))))))),))))))))}})))))))..,{|{{...{((({{{{{...|||}|||))))..(((.....(((((.{((..(((({.((((.,..(((((,({{{(((,.........{((,....(((((.....))))),,))))|.|||....|||.......,))),.))}...)))))..,.,.,.)))),..))}),...))).)))))...}))}.,.},}}})))}))))))))))))))))((((((...(((..{(((.{.((((....)))).}.))).,..))))))))).)))..)))))))..(((((..(((,{((((((((((((((.....((((...(((((,.({((.(((({{({{,..{{{|||,....,....,,|.,}}}))).}}}|,{(({{.{.((((({{{{{{{||||||{..||.||.{((((((.(((.(((,.{((((....((({(((((({{((,{(({({.,{(((.{({(({(({.,{|..{||||{{..||{{,,,..))))..}}.,))))){{,||..,.))))).)..}}}})}}}..})))},}))))),)))}...((,,..}}(((((((.....((((..((((((...)))).))..)))).,))))))),,.)))))))).)))..)))))))..,,||{||,,..|}|}.,|||||},((((({.(((((..(..{(((((..{...(((..((((((.,...(((((....,,((((.{.(((((((((.((((......)))).))))))))),}.)))).....)))))....))))))}}))}.)))))}.(((((..((((((..(((((((...))).))))..))))))..)))))}..)))))....}))))){{,||}|||{,,,,,}.))),)))))},.||||}}}}..))))})))}..)))))))))..)))).....)))))))}}})))))))))......((((((((......))))))))....(((((......)))))))))).))))..)))).)))))),)),,}))))}})}}}}))}},..,))))}||||{||{{|||||||{|..,{|},,,,})))))}},...)))})})))))}))))))))..)}))))))))).))))......))))....))))))))....))..).)))))))))..)))))))))))))))},))))),((,{(({,.(({((((({((,((({{,,,,.,}||||,,|||}}}}}..))...|||||||||...|||,,,)|||||..,})))}}..}}))..}},,)))}},.,||..||||||}}||,|.}})))))).}.,.,||||{||,},,,,..,...)))))))}||}}}}.,,||||||,},.|||||},,|}}}},|}||||,((((((.{..(((((....)))))..}..))))))..,,|((((((((...((((((.{(((((((((.,((..(((((,,.{,,,(((.(,,,((((((((,..((,,{(({((({{.,}|{{|,|||}}|{}||}}}(((({(.((.{((,,,{((((((((((.((((.(((.((((((((((((.(.((.(((((({{(((......}|||||,,..(((,,,({{(((((.,|,{{||.(((((((,..{(((((....)))))))))..)))},,,..{{(,,.(((({{,,,.}}}))),)},,,||.({(..((((,,{..((({{((((((,((((((..((((((((((...(((((((((....)))))))))((.((((((((((..,,(((.(((...{|,,..)).}}|||}..((((....(((((((((...,(((((({((((..((((({....,((((((..{......)..))))))))))))..)))).(((((....))))),(((((((.((..........}.)).)))))))((((((((((....(((((((....((({{(((.((((,.,(((((((((((((((((((((.((((((...(((...))).)))))}((((.........)))),(((....(((((((....))))))).,..)))|(((((((..(..((((((((((((((..............)))))}})))))},))..)..))))))),((((((..(..((((((.(((((.((.{(((((((...((((((((((,..,((((((((((({.((((((.(((..{.((({...|))).}..,||{|||.{{{{({{{,(.((((((((.,,.((((((.((.{{.(.,..,(((((..(((..(((((.(.((.{((.(((((({{(({...}))))).)))).,,)}}.)).)))))).)))..)))))),))))))))))..,.))))))))}.)))}|,,{|}}...,,.,))).}))))))))))))))))))...)))).))))))),}))))))).))))))..)....))))))....(((((((.(((((({((((........)))).,.....|{...........}((((((((.(((((....)))))......)))}))}))..,.)))))).))))))).(((((((((((((((((((((.(((((..(((((((((((((({{.{,{,.........|,.|.||}||))))))),..)))))))..}))))))}|((((.,.,{{{,(((({(({.{(((.|,{((..{{{,.(((((..(({(.(((.{.(({(((((((....))))))).))).).))),)))),.)))))...((((,.(((...|||.|}}|.(((((((....))))))}(((((((.((((({,,((((.{........}.)))}..|..(((((((((((...(((.(((((.((.((((((...))).))).)))))))..)))...((((((((..(((((((.(((.(((((((.(((..(((..((((((((..((......((({(,(((....)))..)),}))...(((.((....))))).(((((..((((((.,.....|||{|{(((((....}},{(((((((((((.....(((((((((((.(....((((...))))..,..).))))))))))).....))))))))))))|||||.||||||...,.)))))).)))))))..).)))))))..))).))).)))))))))).,((((({(.(((((((..{(((((,..(((((.{((,{{{{{...,))}))}}|.(((((((((.(((((..(((((((....)))))))))))).}|.((((((((,((((((,...}))),))}|((,(((((((((...(((((.,.|||}}(((((.(((..((((.(((((({{{({{((((((((((((,,,((,,(({{{..,,,,...))))).},..)))))),,)))))....((((((.{{.(((({....})))).},)))))).||}|||{..,((((,({{...((.(((((((((..((((((.{(.{.((((((....))))))...,,..,})))))).))))))))))),}),,))),))))((((((((((....))))).)))))))))))))).)..)))...)))))...||}((((((((((((....))))))...)))))).))}})))))))))})),.)))))))),,(((...))).((((((((((.(.((((.(,..{(.(((((((((((.((({((..(((((((((....))))))}))).))))).)))))))))))}},(((((......))))).,).)))).).)))))).))))))))))))||},,{((((.((((.((((((....).))).)).)).)).))))}.}}.}}|}}}})}.((((.(((((.,.......,|..)))))..))))(((((((({((((((((((((.((((((....((((((....(((((..((((......)))).))))).,..)))))).)))))).)),.((((((((((.(((..........))).))))))))))....|....((((.(({(((((....})),))).)))))).,,.})))))))))........).)))))))),.....,,.,,...(((.(((((......))))).)))..}))).})}.}},||||,.....||},,}))}|((((......)))),((((((.............)))))))))))))..)))))))).,,.((.((((((.,(,.....)).))))))..)).)).)))))))))))|.,..}))))))))))))((((((((............)))))))),((((.((((.....)))).)))))))),.))).}.))).}.)))))))).))).}..,}})))).((((((,,....,},))))))..))))))))))))))))))..)))))).....)))))))))))).((.((((..,....((((({...}))))).}.,,)))).))..((((....))))..,{.......,,...))))))))).)))))))...{(((.(((((((({.......,})}.))))))))))))))))))))))))))).))))))),,,}}}})))))))))...)))}.)))))))))).)))).)))))))))))...,)))..)))).,)))))))))))),,))),}}..,,..)))),.,)}))))}.,,)))}..})},|,.{{.,({(({,,....,,,}}}))).)}........))))).))..},))}..)))))))})),}.)),)))).)))..)))))))}((((....))))}}},),)))))).)),},.|||.||||..,||}}}})))})),}},)|||,}}}},..}}}|,{{{((({,{.(((((((.(((.....))))))))))|,||||..}}....|||{((({{(.|||,}}}}}}}}|,}})))..))..}}))))))))..))),))),,|{...)}.......)))))))))(((((({.,(((((((((.(((((.((...)).)))))))))))))).,,,...,,)))))))},,...,}))}}||,..{|||||,|||{...........)))),,))}},,..,|||,...}})}))))},,((((((...}))))),||||..,..)))}}(((((((((.{......}.)))))))))...{((((((........)))))))|{|||,,|{|...,,...(((((....)))))...,,...}})..))))}

Transcripts

ID Sequence Length GC content
AGUUUCCCGCGGACCCUGAGAGGAGCGGCCGCCGCGAGUGACUGCACCG… 6207 nt 0.6422
Summary

This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the COL5A3 is overexpressed in the ventral midbrain of a low methamphetamine drinking line and serves as a hub node in a green coexpression module [Hitzemann et al. DOI:10.3390/brainsci9070155], while separate research in murine brown adipose tissue identified the COL5A3 as a specific marker enriched in stromal cells type 1 (ASC1) [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. In human corpus cavernosum tissue, single-cell transcriptome analysis characterized the COL5A3 as a gene marker for fibroblast subclusters, with its expression pattern contributing to the cellular heterogeneity mapping of this tissue [Zhao et al. DOI:10.1038/s41467-022-31950-9].