Basic Information

Symbol
COL6A1
RNA class
mRNA
Alias
Collagen Type VI Alpha 1 Chain Collagen, Type VI, Alpha 1 Collagen Alpha-1(VI) Chain Epididymis Secretory Sperm Binding Protein Collagen VI, Alpha-1 Polypeptide Alpha 1 (VI) Chain (61 AA) BTHLM1A UCHMD1A BTHLM1 UCHMD1 OPLL
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_001848.3
Sequence length
4203.0 nt
GC content
0.6353

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1837.50 kcal/mol
Thermodynamic ensemble
Free energy: -1903.83 kcal/mol
Frequency: 0.0000
Diversity: 1068.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..((((((((((((((((((.(.(((((......))))).).))))).(((((((((..(((((((((.(((.((..((((((((.........)))).))))..)))))..))))))).))...)))))))))......)))))))))..))))(((((((((..(((((..(((...((((((((((((((((((((((............(((.(((((((.(((....)))...)))))))..)))((((........))))....)).)))))..............))))))))))).))))(((((((((((.....))))(((.(.(((....))).).))))))))))..((((((((.....)))...)))))....)))..))))).)))))))..)).......((((((((((((((((((..(((....((........)))))...)))))))......(((((((((.((((((((....(((((((((((.......((((((((.......(((..(((((((.(((((.((((.(((((((.((((..........)))).)))))))((((..((((........((.(((.((...)).))).))...(((((((((((((...((......))))))).......(((((((((......(((((((.......)))...))))....))))..((((((..(((....)))))))))))))).))))))))))))..)))).(((.(((.....))))))...................((((((.......)))))).((..((((((((((.....))).((....))..((((((....(((((((((((.(((((...((((..((.((((((((((.........)))))...((((.(.((((((.....)))))).).))))..(((((((((....((((.((..((((((((.....(((.(((((((....(((((..((....))..))))).((.(((((((..((((.((.((((((((((.((((((....((......((((.((((.(((((..(((..(((((((......((((((((((((((((((......)))..)))))(((..(.(((((((..((....)).)))))))...)..)))......))))))))))(((((((.((((.(((.((((((....((((((((.(((...))).)))..((((((..(.(((((((((((((((((.((..............)).)))).....(((((((((((((((....))).(((((((((..((((((((((((............((.((((((.((((.(((((((((((.((.........(((((((.(..(((.....)))..).))))))).......))))))))..)))))((((((.(((((((.((((((((((((.((..(((((..((((.(((.(((...(.((((((....((((((..((((.((...)).))))..))))))...)))))).)....).)))))))))..))))))).)))).....((.(((((((.((.......)).)).))))))).))))))))))))))).)))))).....))))..)))))))).............)))))))))))).))))..)))))..(((((...(((((((((....(((((((............((((.((..((....))...)).)))).((((((..((((((((..((....)).))))))))..((((((..(((....)))((((((.((....((((((....(.((((..........)))).)))))))(((....))).)).)))))).......(((((((((.(((.((.((((((...))))..)).)).))))))).....(((.(((...(((......)))..))).)))(((((((.((((((((..(((((((((......(((((.(((.(((((.((((((.((((((........)))))).))...(((((.(((((((((((((((((...((........))...))))))..((((...((.....))..))))(((.((((..((((((((((((.......(.((..((.(((((.......))))).))..)).))))))))).((..........))...((((..((((....)))))))))).))..))))))).((....)).....)))).))))))))))))(((((((...((....))...))).)))).........)))).)))))....))).))))).))))))))).............((....))(((((.((......)))))))))))).)))..))))))).)))))..(((((((((.(((..((.((..((.(((.....))).))..)).))))).))))))))).......))))))..........))))))....)).))))))))))))))..............(((((.((....)))))))((((....)))).....((((((....((((((((.((((......)))).))))))))..((((((.((((.((......)).)))).)(((((.(((.(((((..(((.((((((.(((((((.((((((..((((((.....)))))).((((.(((((.....)))))...)))).)))))).))))))).).)))..)).)))..........)))))))))))))......(((...)))..)))))(((((..(((((((((((.((((....((.(((((..(..(.((((.(((((((((((.(((((((....((.(((((...)))))))))))))))))))))....))))..)))))..).)))))))..))))..)))))))))))..)))))..((((((.(..(((((((((...(((((((.((.((.(((......)))..)).)).)))))))..(((((.((.((....)).))))))).............(((((((((((..(((((((......)))))....)).)))((((((.((((((((((((((((((((((((.((((.((.....((((((.................(((((...............)))))(((((((..............)))))))......(((((((((......)))))))))..))))))......)).)))).))...)))))))))......))))).)))))......))).))))))..))))))))...))))))))).))))).))..))))))((((((((((......(((.((.((((.....)))))).))))))))))))).)))))((((((.((((.....))))))))))))))))))))))...))))))))))))).)..)))))))).)))...))))))))).))))..)))))))...))).)))))))..))))).)))))).)).......))....)))))).)))......))))))).)).))))..))))))).))))))))).)))..))))))))..)).)))).))))))))).....................((((......((((.....(((((((((((((...((((((((...(((((((....)))))).).((.(((((((((.((........)).)))))..))))))((((((((((((((.(((((((.((((((((...((..(((......)))..))))))))..).).)))))))..))))).....)))).))).))..))))))))..))))))).))))))......)))).......))))..))))).))...)))).))))).))))).)))))))))))))))).)))..)))))).)))))))))))).))).(((.(((....))).))).........))))))))....(((((......)))))..............))))))))....))).....))).))))))))))))))(.((((......)))))...)))))))))))..((((.......)))))))))).......
Thermodynamic Ensemble Prediction
.{{((({,,((((((((((((((((((.(.(((((......))))).).))))).(((((((((,.(((((((((.(((.((..((((((((.........)))))))})..)))))..))))))).)).,.)))))))))......)))))))}},,)))){{(((((((..(((((..(((...((((((((((((((((((((((....,,,,,.||{{{.((((((({(((....))),,.)))))))..}},((((........))))....)),,))))..............))))))))))).))))(((((((((({.....})))(((.{.(((....))).).))))))))))..((((((((.....))),..}))))..}.)))..))))).)))))))..}}.......((((((((((((((((((..{,.....((,.,,,...))},}.,.)))))))......(((((((((.((((({{(,,,.{{{((((((({,,.....((((((((.......(((..{((((((.(((((.((((.(((((((.((((,{.....,..)))).))))))){{(({{(({({,.,,..,({,(({.,{..,|},||},}}...||{|{{{{(((({......,,,,.}.}}}||,||{(({(((({{({{......{((({(({,,....})).,,))))....}}},.,{{((({..{((.,,,}}}})))}))}}}}.}}|||||||,||..}}||.(((.(((.....})))))...,,...........,{.((((((.,....,)))))).,|,.,{(({,{{{|,,..,})}.|||||{|}}}|}||||,.,.(((((((((((.(((((...((((..{({((((((((((,,,,.....||}}}...|{,{.{.|(((|(.....)))))}.,)))))..(((((((((....((((.((..((((((((.....(((.(((((({....(((((,.((,...))..))))).{,.(((((((..((((.((.((((((((((.((((((....((.....{((((.((((.(((((..(((..(((((((......((((((((((((((((((......})}.,}))))(({,,(.(({{(((...|,,.})},))}}})).,.,..}}}......))))))))))(((((((.((((.(((.((((((..,.((({((((.(((...))).)))..((((((.,(.(((((((((((((((((,((..............)).)))).....((((((((((((...{{{.(({(((((,((((.(((((,(((((((((((...(((..((.((((((((((...(((({.(((((....{,((({{,..,(((,..((((((..((((((({{{(.{({,.,.,..,((((({(((.,,,,((((((.(((((((.((((((((((((.(({,{((((..((((.(((.(((...{.((((((..{,((((((..((((.((...)).))))..))))))}..)))))),),.,.).)))))))))..))))),,.,|||{.......{((((((.((.......)}.)).)))))}}.))))))))))))))).))))))))}}.))))).|}}||{.,,,...}}}......{(((({,(((({(,,...{(((|.{,.(((.,.,|{{.((((((((((.,.((,,.........,}}}.(((((...,..((....)).}...))))).))))))))))..||})}))}.|)|.))))},({{({{|.,(({..{|||(((((({{(,...{{{,{{...,({((({,....,|,..,}||{{|((((({{{,...}},.}||}|||}},,,||,,{{{{{(({{,|{|,||,|{((((,,.|}||,,||{||{||||||,.{{{{{{{.{{{...(((...,,,})}..))),,))||(((((.,.}||||((((((((((((......(((((.(((.(((((.((((((,((((((........)))))).))...(((({{(((((((((((((((((.,.{(,.......))..,))))))|.((((..{{......,}..)))){((,{(((..{(((((((((((.......(,((..((,(({((.......))))).}}..)).))))))))).))},,.....,,)}..{((((..((({....)))))))))|,|,,.,,})),),|(,...,}...,,)))),,)))))))))))(((((((...((....))...))).))))........,)))).)))))....))).))))).)))))))))...})}..,}},,}},.}||||,((({(....{(((((({(({((({{{,|..{(((|.|.{(((((((((((((((.(((..((.((.,((.(((.....))).)},,)).))))).)))))))){(({.....)))){{{.......))).........))))))))..}}|||((.,.,{,{{.,,,,(((((.((....)))))))||||,,,|))}}.....{{.{,{{{{{{(((((((.((((......)))).)))))))){(.(((.{.((((.((......)).)))).}...))).))}|||,)))))))}}},.}}|||||,|}||||(((.((((((.....)))))).}||{{(({{{,,,,,)}}}}...,)))})))),,.)))))||{,{{|,..},|}}....,,...((((|,...}.))))...}}})}}}}}))||..(((.(((((..(((((((((((.((((....((.(((((..{..(.((((.(((((((((((.(((((((....((.(((((...)))))))))))))))))))))....)))).,}))))..}.)))))))..))))..)))))))))))..))))).))){{{{{{..|,.|||......(((((((.{{,({.(((,,....}}),,)},)).)))))))..,,,))),,}}},)))})}}})}))))))}}.}}|.))})))}},)}})).,))}}}|||((,,{,|,,..,,,...),,.)))))})))))),})))}))))))))..)))))),.}|.,,,.,|}|}))}......))))).|.{(((((...............)))))|(({{{{.......,,,,.,,}}|||}},{,{...,,||||{{,,,.,,}))))||{(,,(((.{{{{....)).)))))))}}})))).))))))))))}),))}.((((((.({.((.....)).}).))))))|))))))))).}},|||{(,{{....,}},((((((((((||....(((.((.((((.....)))))).))))))))))))))))))).))))),((((.....)))))))))}))))))))))))...))))))))))))).,,,))))))}}.))),..))))))))).))))..)))))))...))).)))))))..))))).)))))).))..,,,..))....)))))).))),.....))))))).)).))))..))))))).)}))))))).)))..))))))))..)).)))).))))))))).....................{(({.,....((((....,(((((((((((((...((((((((....{(((((....)))))}.,.((.(((((((((.((........)).))))}.,))))))((((((((((((((.(((((((.(.((((((...((..(((......)))..))))))))..}.).)))))))..))))}....,)))).))).})..))))))))..))))))).)))))).,....)))).....,,))))..))))).}}}},)))).))))).))))).))))))||,}}.}})).},}..,,)))).)))))))))))),))}.((({({(....}}}.},,,}}},....)))))))).,,,|,{{{,.{{{{|,,,,.}}}},.,,,....)))))))}...,})).....))).)))}}))))))))){.({((......))))).,.))))))))))){{((((,......))))))),,,.,,,,,.

Transcripts

ID Sequence Length GC content
AGAAGGCAGCCUCGGUCUCUGGGCGGCGGCGGCGGCCCACUCUGCCCUG… 4203 nt 0.6353
Summary

The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice identified the COL6A1 as a key candidate marker for fracture healing, being one of the top 10 hub genes with the largest degree of connectivity in the protein-protein interaction network of common upregulated mRNAs and showing the largest fold change [Li et al. DOI:10.1155/2021/2866475]. In human research, the COL6A1 was identified as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192].