Basic Information

Symbol
COMP
RNA class
mRNA
Alias
Cartilage Oligomeric Matrix Protein TSP5 Thrombospondin-5 THBS5 TSP-5 MED Cartilage Oligomeric Matrix Protein (Pseudoachondroplasia, Epiphyseal Dysplasia 1, Multiple) Multiple Epiphyseal Dysplasia PSACH EDM1 EPD1 Pseudoachondroplasia (Epiphyseal Dysplasia 1, Multiple) CTS2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000095.3
Sequence length
2452.0 nt
GC content
0.6419

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1060.10 kcal/mol
Thermodynamic ensemble
Free energy: -1097.47 kcal/mol
Frequency: 0.0000
Diversity: 533.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((.........))))(((((((((((....(((...))).((.((((.((((((((.((((((((((...((((.(((((((((((.((((....((((((...))))))...))))...)))..)))))........(((((((((.(((((((.((((((..(((...((((((((((((((....)))).(((((((.......)))))))....((((.(.....).))))..(((((((((..((((..(((.((((((...((....))..)))))))))..))))..).)))))))).)))))))))).))).)))))).)).(((((.(.((((..(.((((.(((.((((..((((..((((...)))).....))))..)))).))).))))..)..))))...).))))).((((..((..(((...(((((((((((((((....)))((((...((((((...(((((..(.((((((.(((((...((((((((((((((.....)).))))))))(((..(((((.(.(((.....((((..((((.(((...(((.......)))..))).)))).....))))(((((....(((((((.(.((.....((((((......((((.(((((((((((..((((((((((((((((......))(((((((((((((((((((((((.((((.(((((.(((...((((((...))))))....)).)...)))))..))))......(((((((.(....).)))))))))))))))))))))(((((((((((.(((((.((((((.(((((......))))))))).))..))))).....(..((((((.((((((..((((.((((((....)).).)))))))..)..(((((......)))))((.((((.(.(.((.((.((((((((((..((....)).))).))))))).)).)).).).))))))........((.(....)))(((((((..((...))..)))))))...(((............)))))))).)))).))..)...)))))).)))))...........((....))...))).)).)))).((((...((((((((......))).))))).))))..(((.((((((.((((.((((...((((.(((..(((.(........))))...))).))))..))))..))))....(((.((((((.(((....)))..)))....))).))).......)))))).))).(((((....)))))..((((((......))).)))........((((........))))((..((((.(((((....)))))..(((((......)))))..))))..))....)))))).)))).))))...)).((((.((....)).)).))...)))).(((((........)))))....))))))))).......))))))....))).)))))))..)))))))).).))))).....)))...((.((((((.......)))))).))...........(((..((((.((((..(.((((((((.........)))))))).)..)))).))))..)))))))..))))).))))))).)))))...))))))..))))(((..(((((.(((((...(((...((((..............)))))))...)))))...)))))..))).(((......))))))))).))).)))(((((...))))).....(((((.((((((.(.((.....))).)))))).))))).........((((((((((((((((....))))))))))...))))))....)))..))..))))....((((((..((.(((((((.((((((............((((.((..(((((((((((((.(((.((.....)).)))...)).)))))).......))))).)).)))))))))).))))))).))))))))(((((((...)))))))..(((((((.....))))).))))))))))))))))((((((((((....))).....(((((((.(..........).))))))))))))))((((.((((.....((((((((......))(((((((.(((((.((((((((..........))))))))(((......))).))))).)))))))..((.(((..(((....)))..))).)).....)))))).....))))))))..))).)))).))))))))))..(((.((((..(((.((((((((....(.((((((.((.((...)).)).)))))))...)))))))).)))))).).))).....)))))))).))).).))..........))).))).)).))).
Thermodynamic Ensemble Prediction
.......((((.........))))(((((((((((..,.((({.,|.,.,|,{(((.((((((((.((((((((((...((((.((({{(((({(.{,(({{,.((((((...)))))}...}}))}}}))},.}})))..,,|...((((((({{{(((((((.((((((..(((...((((((((((((((....)))).(((((((.......)))))))...,((({.{.....},)))}..(((((((((,.((((..(((.((((((...((....}),.)))))))))..)))),,).)))))))).)))))))))).))).)))))).)).(((((.{.((((..(.((((.(((.((((..((((..((((...)))).....))))..)))).))).))))..)..))))...).))))).((((..(({{(({..{(({(((((((((.{{,,,.,(,((((,,.((((((...(((((..{.((((((.(((((...(((({(((((((((.....)).)))))))|((({{(,,,,,}}|||.....((((..((((.(((.,.((,.{....)))),.))).)))).....))))(((,({..{(,,((,({({(({,...,{(({{.{{{,.,(({,((((((((((((..((((((((((((((((,...(.(((({((,,({(((,(((((,,,,.||||}.||||,}|}}}},|||||}},})))).}}}.,,.,...,,,|.{{(({{{{{.,,,({{{{..},))})}|||,||,||,||||||,||||(((((((((((.(((((.((((((.(((({......})))))))).))..))))).....{..(({((({((((((,.((({{((({((....)).}.,))))))..),.{((((......)))))((.((((.(.(.((.((.((((((((((..((....)).)))}})))))).)).)).).).))))))........||....,,|}}{((((((..((...))..)))))))...{{{............)))))))}..)))}))..}...)))))).)))))...........}}},..)).)})),}))},))){(((({{(((((((((......))).)))))..(((,,(((.{(((.(.((((.((((.,.((((,({(..(((.,........})))...})).)))),.))))..))))...),)|}|,,{(((.((((.{(((((((,{{{.|,...(((.(((.....))).)))....,,.}))).)))).)))}.)))).))))}.|}}.,{.((..((((........)))).)).})}},(((((....))))).)))))))....,{,|||{{{{.{{,|,,.,.{{,{{{{,|,|{{{|,...,}|||{{.{{....|}.}}.,...,.})}.}})||}}...}))))).,....})),))))).}}},..))))))}}..,))})))))),..))),,)))})}))),,}},.})}}}}}|{.,|||||}}}}}.}),})))}),.}}}.....,,(({..((((.((((..(.((((((((.........)))))))).)..)))).)))),,)))))))..))))).))))))).)))))...))))))..}}))})))))|.,..((({{,,,(({,{.((((........}}....}}|||||,,,|}}}),,.})))),.},),{||,,,..,))}))))))}})).))){{(((,..,}}}),....(((((.((((((.{.({....}),}.)))))).)))))..,,},...((((((((((((((((....))))))))))...))))))....}},..))..))))....((((((,.{(.(((((((.((((((............(((((((......,.)))}||)}(((.((.....)).)))...{(((((((..........}.)))))))).)))))).))))))).))))))))(((((((...))))))).,(,(((((.....))))).))))))))))))))))((((((((((....))).....(((((((.(..........).))))))))))))))((((.((((...,.((((((((......))(((((((.(((((.((((((((..........))))))))(((......))).))))).)))))))..((.(((..(((....)))..))).)).....)))))),....))))))))..))).)))).))))))))))..(((.((((,,({{.((((((((....(.((((((.((.((...)).)).))))))}...)))))))),))))}).)}))).....)))))))).))).}.))}}........))).))).)).))).

Transcripts

ID Sequence Length GC content
AGAAAGCGAGCAGCCACCCAGCUCCCCGCCACCGCCAUGGUCCCCGACA… 2452 nt 0.6419
Summary

The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein . It consists of five identical glyco protein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM protein s such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]

Forensic Context

A study in human and rat corpus cavernosum demonstrated that the COMP is a fibroblast subtype marker and extracellular matrix protein, where in rats, the COMP+ fibroblast subcluster was dominant and widely distributed [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in mice demonstrated that the COMP was identified as a gene expression marker and a potential key factor separating low- and high-functioning aged groups, showing differential expression with reversed patterns between 24-month-old low-functioning and high-functioning mice after laparotomy [Asche-Godin et al. DOI:10.1093/gerona/glac043]. In human skin, single-cell analysis identified the COMP as a marker for a mesenchymal fibroblast subcluster within the wound healing roadmap [Liu et al. DOI:10.1016/j.stem.2024.11.013].