| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAAGCGAGCAGCCACCCAGCUCCCCGCCACCGCCAUGGUCCCCGACA… | 2452 nt | 0.6419 |
The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein . It consists of five identical glyco protein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM protein s such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
A study in human and rat corpus cavernosum demonstrated that the COMP is a fibroblast subtype marker and extracellular matrix protein, where in rats, the COMP+ fibroblast subcluster was dominant and widely distributed [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in mice demonstrated that the COMP was identified as a gene expression marker and a potential key factor separating low- and high-functioning aged groups, showing differential expression with reversed patterns between 24-month-old low-functioning and high-functioning mice after laparotomy [Asche-Godin et al. DOI:10.1093/gerona/glac043]. In human skin, single-cell analysis identified the COMP as a marker for a mesenchymal fibroblast subcluster within the wound healing roadmap [Liu et al. DOI:10.1016/j.stem.2024.11.013].