| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCACUCGACUACCAAGAUGGCGGCCCCCGGGAGCUGUGCUCUAUGGAG… | 1506 nt | 0.4728 |
Enables 2-methoxy-6-polyprenyl-1,4-benzoquinol methyltransferase activity. Involved in methylation and ubiquinone biosynthetic process. Located in mitochondrial inner membrane and mitochondrial matrix. Part of ubiquinone biosynthesis complex. Implicated in primary coenzyme Q10 deficiency 9. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that the COQ5 is a member of a brain gene co-expression module associated with voluntary alcohol consumption, where its expression is negatively correlated with alcohol intake [Saba et al. DOI:10.1111/Gbb.12698]. In mice, the COQ5 was identified as COQ3, a coenzyme Q3 homolog and methyltransferase, and its expression was significantly up-regulated in brain tissue at 8 and 24 hours following whole-body ionizing radiation exposure [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418].