| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACCCGCGAGCUUACACCGGCUUCUCUCUGUCCUCAGCCCGCGCGCCGC… | 1173 nt | 0.4544 |
Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22. [provided by RefSeq, Jul 2008]
A study in Sarcophaga peregrina demonstrated that the COX5A gene shows an increasing expression tendency with intra-puparial age under both constant and fluctuating temperatures, and polynomial regression models for this and five other differentially expressed genes showed significant relationships (p < 0.001) between expression level and age, with coefficients of determination (R²) ranging from 0.89024 to 0.98587 [Shang et al. DOI:10.3390/ani13101607].