Basic Information

Symbol
COX5A
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 5A Cytochrome C Oxidase Subunit 5A, Mitochondrial COX-VA Cytochrome C Oxidase Polypeptide Va Cytochrome C Oxidase Subunit Va Cytochrome C Oxidase Polypeptide, Mitochondrial Mitochondrial Cytochrome C Oxidase Subunit Va MC4DN20 COX VA
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_004255.4
Sequence length
1173.0 nt
GC content
0.4544

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-329.70 kcal/mol
Thermodynamic ensemble
Free energy: -356.09 kcal/mol
Frequency: 0.0000
Diversity: 355.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((.(.((..((((((((((((((((..(((((.(((.((((...((......))..)))).))).....(((((.(((..(.(((((.......((((((.((......(((...)))....)).)))))).....))))))))).)))))....((((......)))).........)))))....)).)))))).))))))))))).)))))).))))....(((((.....(((..((((((..(((..(((((..(((...(((((..((((....))))...((((..((((((((((((..((((((((((...((((.((((((....))))))))))..)))))))))).(((((((((((((((...((((((((((...)))))(((((((((.((((.((........)).))))....(((((((((...................((((...(((((.....)))))..)))).(((((...((((.((..((....)).)).))))...))))).....((.(((((........))))).)).)))).)))))((((((..((((.((((...(((((.((((((((..(((((((((((((((((.(((((((((...))))...))))))).))))).))))))))))..))))......)))).)))))..))))))))))))))..(((((((((((..........)))).))))))).....)))))))))..)))))...)))).....)))))))))))...)))))).))))))....))))......(((.(((((((..(((((((((((.(((((((.............)))))))..((((...(((.(((....)))))))))).(((((....))))).((...((((((((....))))).)))...)))))))).....)))))....))))))).)))..((((.((.((((((((.......((((.((.(((((...)))))))...))))....((......))..)))))))).))))))...)))))...)))..)))))..)))....)))))).(((((.((.........((((((...)))))))).)))))..............)))))))).......
Thermodynamic Ensemble Prediction
.((((((((((.{.{{..((((((((((((((((,.((((({(((,((((...({......)).,)))),))).....(((((.(((..(.(((((.......((((((.({.....,(((...}}},...)).)))))).....)))))}))).)))))....{(({,,,...}))),.........))))....)).)))))).))))))))))}.)))))).))))....(((({,..,.(({.,({,,(({{((({{(((((..(((,.{(((((..(((({{{{,{{,...,,{{..((((((((((((..((((((((((...((((.((((((....))))))))))..)))))))))).((((((((((((({(...((((({((((,{{|,},.{((((((((.((((.((........}).))))...{(((({{{((,,,..,,....,.,.|,..|||||..,((((.....})))}..}}}}|||||},}}}{(({{{,,{|||,|||,||||,,},))}},},.....,{.(((((........))))).},,||}}.})))}|,{{{{,.{{{{.{(((.{.{((((.{(((((((..(((((((((((((((((.(((((((((...))))...)))))))))}))))))))))))))..)))))},...,,,,.)))))..)))))))))))))}|}|||,,,,,(((,,,,,,{,..,|||.,,}})))..,..))))))})),,)))))...)))).....)))))))))))...)))))))}})))).,,,}},}....{{((({,,(((,({{,((({(({..,}}||||,}}}.,,,.)))))|{|,|{{{..((((...{,,.(({....)))}}})))).,,||}}.}}}||||{.,{({(((,((((.{{.|{{.,{{{{,,,{{|||||,...,.|||||....,,,,,,,})))}.,||{.||,|||,{{{|.,,,.}}||,{.||}{||,{}}})))))))..}))},....))))))}),,)))))),}))),,,,))}},...,,..,|||,.,,,,},,)}}}.|||}},...|||{{,||........,{{{{{{..,))})}},}.}))))},,}}}.,......)})))))}.......

Transcripts

ID Sequence Length GC content
AACCCGCGAGCUUACACCGGCUUCUCUCUGUCCUCAGCCCGCGCGCCGC… 1173 nt 0.4544
Summary

Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sarcophaga peregrina demonstrated that the COX5A gene shows an increasing expression tendency with intra-puparial age under both constant and fluctuating temperatures, and polynomial regression models for this and five other differentially expressed genes showed significant relationships (p < 0.001) between expression level and age, with coefficients of determination (R²) ranging from 0.89024 to 0.98587 [Shang et al. DOI:10.3390/ani13101607].