Basic Information

Symbol
COX5B
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 5B Cytochrome C Oxidase Subunit 5B, Mitochondrial Cytochrome C Oxidase Subunit Vb Cytochrome C Oxidase Polypeptide VB, Mitochondrial Epididymis Secretory Sperm Binding Protein Cytochrome C Oxidase Polypeptide Vb COXVB
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001862.3
Sequence length
690.0 nt
GC content
0.5174

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-241.70 kcal/mol
Thermodynamic ensemble
Free energy: -251.63 kcal/mol
Frequency: 0.0000
Diversity: 110.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((.((((((((((((.(((...(((((((((....)))...))))))....(((((((((((..(((((...))))))))))))..))))..))).)))))(((.((((((((((....((.(((((((((.((.((.....(((((((.(.((((.((((((((.((((....(((.....))).....(((((((((.........(((...((((((...))).)))....)))..((((....))))..))))))))))))).)))))))).......)))).).)))).)))....)).))..)))))))(((((((..(((((((.((......)).)))))))..))))))))))))))))))))).))).....(((((....))))).)))))))))((((((((.((((((......((((((((((((((.((((......)))).)))))(((((((((((((....(((.........)))..)))))))))))))..........((((((((.((.....)).))))))))..)))))))))..((((((.(.......).))))))......(((((.....))))).......))))))..)))))))).........................(((((..........)))))(((....)))....
Thermodynamic Ensemble Prediction
.....{(.((((((((((((.{((..,(((({{,,(,...}}}|,,|}}|||{,..{{{{(((((((..(((((...)))))))))))),})))}.}))).)))))(((.((((((((((....((.(((((((((,({.((.....(((((((.(.((({.((((((((.((((....(((.....))).....(((((((((.........,||.,|{(((((...))).}}|..,})),..((((....))))..))))))))))))).)))))))).......}))).).)))).)))....}).)),.})))))}((((((,{{(((((((.((......)).))))))),}))))))))))))))))))))).))).....(((((....))))).)))))))},((((((((.((((((......({(((((({(((((.((((......)))).)))))(((((((((((((....(((.........)))..)))))))))))))..........{({{{(({.{(,,,,,||,}}}})))),.)))))))))..((((((.{.......),})))))......(((((.....))))).......))))))..)))))))).........................(((((..........)))))(((....)))....

Transcripts

ID Sequence Length GC content
AGUUUUGCUGCUAGUCGCGGACGCAAUGGCUUCAAGGUUACUUCGCGGA… 690 nt 0.5174
Summary

Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the COX5B is a marker for high-energy metabolic cardiomyocytes, being enriched in the ventricular cardiomyocyte cluster vCM4 alongside other nuclear-encoded mitochondrial genes [Xinxin Bian et al. DOI:10.3892/mmr.2025.13680]. In human forensic investigations, the COX5B is identified as an emerging biomarker of metabolic and mitochondrial dysfunction in cases of unexplained sudden death [Sacco et al. DOI:10.3390/ijms27020670].