| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUUUGCUGCUAGUCGCGGACGCAAUGGCUUCAAGGUUACUUCGCGGA… | 690 nt | 0.5174 |
Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the COX5B is a marker for high-energy metabolic cardiomyocytes, being enriched in the ventricular cardiomyocyte cluster vCM4 alongside other nuclear-encoded mitochondrial genes [Xinxin Bian et al. DOI:10.3892/mmr.2025.13680]. In human forensic investigations, the COX5B is identified as an emerging biomarker of metabolic and mitochondrial dysfunction in cases of unexplained sudden death [Sacco et al. DOI:10.3390/ijms27020670].