Basic Information

Symbol
COX6A1
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 6A1 COX6AL Cytochrome C Oxidase Subunit 6A1, Mitochondrial Cytochrome C Oxidase Subunit VIa Liver Isoform Cytochrome C Oxidase Subunit VIa Polypeptide 1 Cytochrome C Oxidase Polypeptide VIa-Liver Cytochrome C Oxidase Subunit VIA-Liver COX VIa-L COX6A Cytochrome C Oxidase Subunit VIa Homolog CMTRID
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_004373.4
Sequence length
537.0 nt
GC content
0.5289

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-180.00 kcal/mol
Thermodynamic ensemble
Free energy: -189.58 kcal/mol
Frequency: 0.0000
Diversity: 118.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((((....((((.(((((.(((((....((((((((((((((((.((((.((....))))))))))..(((((.(((......)).).)))))..(((((((((((...((((..(....)..)).))....)))))))))))..((((.((((((((((..((((.((((.....))))..)))).))))).)).))).)))).))))))).)))))..))))).))))).))))....).))).)))).(((((((((((..((((..((((...............))))..))))...(((....))).........(((((.(((.....(((((.((....((((((.((((.((((...(((..(((....(((..(((((.((((..........)))).)))))...)))...)))..)))...))))..............((((....))))...))))...))))))....)).))))))))))))).)))))))))))....................
Thermodynamic Ensemble Prediction
.((((.((({....((((.(((((.(((((.,..((((((((((((((((.((((.((....))))))))))..(((({,((..,....},.))))))).,(((((((((((...((((,.{....},.}).))....)))))))))))}.((((.((((((((((..((((.{(((.....)}))..)))).))))).)).))).)))).)))))))})})))..))))).))))).))))....}.))).)))).(((((((((((,((((({{((((...}}}}.}}}}..,||||..,,|,..,(({....|||.,,....,,|,{,,|,||.,,..,,.,|.|...,|{{||||...,|}|||,.,.|||,.((({({{(..{{,,(((.,,((......,,..,,||{||||,..,||,...|||{.,,,...}))),....,,,|{{{,(((((....))},,}.))))..})))))).}}},.}),.)))}}))))).)))))))))))....................

Transcripts

ID Sequence Length GC content
AGUCCAGAUCAAAAAUGGCGGUAGUUGGUGUGUCCUCGGUUUCUCGGCU… 537 nt 0.5289
Summary

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in the electron transfer and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.