Basic Information

Symbol
COX6C
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 6C Cytochrome C Oxidase Polypeptide VIc Cytochrome C Oxidase Subunit VIc Preprotein Epididymis Secretory Sperm Binding Protein Cytochrome C Oxidase Subunit VIc
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004374.4
Sequence length
744.0 nt
GC content
0.4046

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-213.50 kcal/mol
Thermodynamic ensemble
Free energy: -227.57 kcal/mol
Frequency: 0.0000
Diversity: 229.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((....))))(((((((((((.(..((((((((((......)))))))))).).)))))).(((((.....(.......).....))))).((((((((((((((((((((.(((((((.(((((((.(((((....))))).)))))))(((((((.(((((((((((......(((.((((....)))).)))..((((((.((((((((((((.((.............)).)))))).)))))).))))))..)))))..))))))...))))))).((((((.(((..((((.........((((((((.(((....)))(((((((((.((((((((..((((......))))))))))))(((...)))))))))))).(((((((..(((((....))))).........)))))))...(((.(((........))).)))))))))))(((((((((((((..((((((((((.......(((((........)).)))))))))))))...))))))).)))))).....))))..))).))))))).)))))).)))))))))..(((....)))......((((((((((..............))))))))))...))....)))))))))............(((((..(((((((..((((....)).)).)))))))...)))))((((((............))))))..)))))....
Thermodynamic Ensemble Prediction
...,,((((....))))||{{.((((((.{..((((((((((......)))))))))).}.)))))).{(({{{{,,{{{|,,{{((({(,,{{{{{.(((((((,,,{(((((({{(,(({{{{{.(((((((.(((((....))))).))))))){|{{{{{.{{{(({,((((|.,,,,{||,||{{.,,}})))}))}}}||||{{.|{{{{{|||||{.||,,||.......,,||,}}}}}}.||}}||.}}}})}..}},}|,.||}}}}...)))|))),{(((((,{((,,({({,{{{,,,{{((((((((.,{{....}},(((((((((.((((((((..((((......))))))))))))(((...)))))))))))).(((((((..(((((....}))))..,......}))))))...{{{.{,,.......,}}}.,,.})))))}}(((((((((((((..{(((((((({......,(((((........)).)))))))))))))...)))))))}}))))),},,}})}}..})},}))))),,)))))),))))))))}..,{|,,.,}}}}|,...||,|||||||}},,,,,......,}}}|||||}|..,||{{{,|||||||||,........,,}}|}}|,}{|||||,.|||||,,..)),})})))))}}....|{{.((((((............))))))))))))),...

Transcripts

ID Sequence Length GC content
AUUCUGCGCCUGCGCGCGGCUACAGCACGGUUCGUUUUUCCUUUAGUCA… 744 nt 0.4046
Summary

Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]

Forensic Context

A study in humans demonstrated that the COX6C gene, encoding a subunit of cytochrome c oxidase, was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart of patients who succumbed to septic shock compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].