| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUGCGCCUGCGCGCGGCUACAGCACGGUUCGUUUUUCCUUUAGUCA… | 744 nt | 0.4046 |
Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]
A study in humans demonstrated that the COX6C gene, encoding a subunit of cytochrome c oxidase, was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart of patients who succumbed to septic shock compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].