Basic Information

Symbol
COX7B
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 7B Cytochrome C Oxidase Subunit 7B, Mitochondrial Cytochrome C Oxidase Polypeptide VIIb Cytochrome C Oxidase Subunit VIIb Cytochrome-C Oxidase Chain VIIb LSDMCA2 APLCC
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001866.3
Sequence length
2444.0 nt
GC content
0.4141

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-668.90 kcal/mol
Thermodynamic ensemble
Free energy: -718.08 kcal/mol
Frequency: 0.0000
Diversity: 648.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((.((.(((..(((((...(((((((((((((((....(((....)))....)))))..))))..)))))).......((((((((.(((((......(((........)))..)))))...))))))))...((((((.(((..(((((.(((((((((..........(((((((........((((((((...))))))))((..((((....))))..))((.((((((((((....)))))))))).)))))))))........((((((((((.......))))).))).)).((((((...(((.((........)).)))..((((((((....((((.((((((...)))))).))))...((((((((.(((.....................))).))))))))..((((((((((((((((..((((...)))).))))..)))))))))))).....((((((((.((((((((((((((((((.........((((.(((.....(((...)))....))).)))).............................((((((((((...))))))))))..))))))))))((((((((.........)).))))))((.(((........))).))..((((..(.((((((((.((((.....((((......))))))))...((((......((((((((.............(((((((((((..((.((.((..((((((((.(((.((((..(((.........)))..))))...)))))))...)))).)))).))..)))).))))))).........))))))))......((.(((((((....)))...(((((...........))))).((((((((((((.((((.(((.....)))))))...)))).)))).))))(((((((...(((.((((....)))).)))...))))))).((((.....))))))))))))))..................)))))))))..))))......))))))))))))))))..((((((.(((...(((((((..((((.((((....)))).))))..)))))))))))))))).....))).))))).......(((((((((.(((((((..(........)..))))))).....)))))))))..((((((((........))))))))....(((((.((.((...)).))))))))))))).(((((....)))))))))....))))).)))))........(((((........(((....)))........))))).......(((((((((((((.((((.....(((...)))(((....)))....)))))))))(((((.((((((((((...(((((..(((....)))..)))))(((((....))))).....(((..(((((...((((((((((((((((((((((...(((((((((.((.........(((((((((((((((...(((((.(((.(((....(((....)))....))).)...(((((((....))))))).....)).))))).))))).)).))))))))..((((((............))))))...((((((((((((....................))))))))))))..(((((((.((..(((((.((...((.((((.((..(((((((.(((.......))))))))))..))..))))...))...)))))))..)).).)))))))).)))))))))..)))))...(.(((((.......(((((((((((((...........))))).(((((.(((((...(((...)))..))))).)))))((.(.((((....)))).).))......(((.(((((.....)).))))))....)))))))).......))))).)......................))))))))))))))))).)))).)..)))))))))))))...................((((..(((((....)))))..)))).((((......))))((.((((...)))).)).....(((.(((......)))))).........(((.(((((..(((((((.....)))))))...)))))..))).......)))))((((((...))))))....))))))))...(((((((....((((((......)))))))))))))............))).))))))....(((((((.((((((((.(((((.(((((...)))))...))))).)).)))))).))))))).......)))))))).))..))))))............((((.(((.((((.......))))..))).))))
Thermodynamic Ensemble Prediction
.,,{(((((.((.({{{.{((((...(((((((((((((((....(((....)))....)))),.,))))..))))))....,,,((((((((.(((((......(((........))}.,)))))...)))))))},{{,((((((.((((((((((.((((({((....,,....,||,,,{{{{,,...{{{{{(({.,,||||}}}|,{,{(({({{{{||||...(((.((((((((((....)))))))))).))),}|,||,{{{{...((((((((|(|......))))).))}.}},{{,,{{..,{{{|{{,,,,,,..,,.,,|,.||{{{{{(,,,.((((.((((({...}))))).)))).,.{(((((((.,({...,....,,|,...|,|,..,},.)))))))}.,((((((((((({((((..((({...}))).))))..)))))))))))),....(((((((,{((((((((((((((((((...,,,,..{{{{,{((..,,,{(({,.|||,,..,,..,,.}},...........................((((((((((...))))))))))..}})))}}}}|((((((((.........)).)))))){{.{{{.,......))).}}..((((..(.((((((((.(({{.....((((......)))),|||...,|||.,,...((((((((.,,,.........(((((((((((..((.((.((..((((((((.(((.((((..(((.......},)))..))))...)))))))...)))).)))).))..)))).)))))))......}}}))))))))....}|{{|{,..{{|,,,.}||,.{(({{{...........,}})).|}|||||||{{||||{..,..|||||||||{||..},.||||}}}|||,.(((((((...(((.((((....)))).)))...))))))),)))}.))))),))))))}})))}....,}}.,.,..,,}},)))))))))..)))).....,))))))))))))))))..((((((.(((...(((((((,{(,((.((((....)))).)))),.))))))))))))))))....{||||||||}|......,{{{{{{{,,{((((,..{(.{((((......,,))))},||.,,,,,)))},.{{{{{{{{..,,,...}}}}}}},....(((((.((.(,...,).))))))),},,,}.(((({....}))))}}}},...||||,,||||,....,,,.|||||...,,...|||...,})},}}},..,))))),},,...}}},,,{(((({(.{(({.....,,,....||(((....))),,,,})}}))))}}||,,......,,..,,,.(((((..(((....)))..))))).,)}}))}))))))...})))}}.........(((((((((((((((((,{{({...(((((((((.{{...,{{{{,.,,,.{{{{.,,|||}|,|,,,,}||,.|,{,,..((((.((((((.{(({,.{{..(((((((....))))))).,}..},)))..)))))).}))}...,}||{{{{{{{({........})))))}},,,..((((((((((((....,{{.....,,},....))))))))))))..(((((((.((..(((((.((...((.((((.((,{(((((({{(((.......)))))))))).,)),.))))...))...)))))))..)).,.)))))))}.)))))))))..}}))}...{.(((((.,{....(((((((((((((...........))))).(((,({(((,,,..((,...,||.,}}},)}))),,{{.{.((((....)))).).,,..}}}}.}}}(((((..(,...})..)))))..)))))))).}.,,..))))).},.....................))))))))))))))))).)))))..))))))))))))))),.})),,,......,.,.{,,,..{{{{|,,,,)}}}|.{||||{(|||{{{,|{|,,.((.((((...)))).}}..,..{{{.{{{.....,))}))),},..,|,,|||,(((((..(((((((.....)))))))...))))}(((((.(((((((({.,,.,{{{...),}))))))))).)))))...{((((((....((((({......})))))))))))).,,...|,,,},}..,}||}}}|,..{((((((.((((({|{{(((,,.,{(({{.{|,,},}}.))))),))})))))).))))))).......)))))))).)}..}))))}...........,((({.{{{.((((......}))))..})),))}}

Transcripts

ID Sequence Length GC content
GUUUUUCAGCUCACUUCAAGGGUACCUGAAGCGAAUUGGCACCAAAGCA… 2444 nt 0.4141
Summary

Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIb, which is highly similar to bovine COX VIIb protein and is found in all tissues. This gene may have several pseudogenes on chromosomes 1, 2, 20 and 22. [provided by RefSeq, Jun 2011]

Forensic Context

A study in humans identified the mitochondrial gene COX7B as a biomarker for sepsis prognosis and diagnosis, where patients with lower expression levels exhibited significantly higher 28-day survival rates [Li et al. DOI:10.1186/s12920-024-01891-x].