Basic Information

Symbol
COX8A
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 8A COX8L COX8-2 VIII-L VIII COX8 COX Cytochrome C Oxidase Polypeptide VIII-Liver/Heart Cytochrome C Oxidase Subunit VIIIA (Ubiquitous) Cytochrome C Oxidase Subunit 8A, Mitochondrial Cytochrome C Oxidase Subunit VIII Cytochrome C Oxidase Subunit 8-2 Cytochrome C Oxidase Subunit 8A (Ubiquitous) MC4DN15
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004074.3
Sequence length
494.0 nt
GC content
0.5789

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-181.00 kcal/mol
Thermodynamic ensemble
Free energy: -188.68 kcal/mol
Frequency: 0.0000
Diversity: 132.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((....((((((((((....)))).....(((((((((...))).))))))(((......)))(((.((((....))))))).(((((((.(((((((((((((.......)))))(((.(((((.....)).))).))).((((((((((.(((.((.((.(((...((((....))))....)))))..)).))).))))).))).))..))))))))..))))))).......)).)))))))))))))))))).((((((.......((.((((((....(((((.(((((((.....((((((((...((((......))))....)).))))))......)))).))).))))).........((((((......(((.(((........))))))......)))))).....)))))).))..((((((((...))))))))))))))...........................
Thermodynamic Ensemble Prediction
.,,,{(((,{({,{,{...{(((.((((...,|||}.....{{|||{{{{.,,)))}}}}}},{{{......))}(((.((((....))))))).(((((((.(((((((((((((.......)))))(((.(((((.....)).))).))).((((((((((.(((.((.{{.(((...((((....))))....)))}}..)).))).))))).))).))..))))))))..))))))),,,,{((((({.|.{{(((((,||||{{(((((((,.....,,{,|,,|,|,...(((((.(((((((.....((((((((...,(({.,.,..}}}},...)).))))))......)))).))).))))}.......}}|.,}}},,,,}.}|,.}},}).))})}))}.))))))}.||||{{{{{...,))))})}},{(((({{{...))))))))}))),,,..........................

Transcripts

ID Sequence Length GC content
AUUUUGGCUUCCUGACCUUGGGCUACGGCUGACCGUUUUUUGUGGUGUA… 494 nt 0.5789
Summary

The protein encoded by this gene is the terminal enzyme of the respiratory chain, coupling the transfer of electrons from cytochrome c to molecular oxygen, with the concomitant production of a proton electrochemical gradient across the inner mitochondrial membrane. In addition to 3 mitochondrially encoded subunits, which perform the catalytic function, the eukaryotic enzyme contains nuclear-encoded smaller subunits, ranging in number from 4 in some organisms to 10 in mammals. It has been proposed that nuclear-encoded subunits may be involved in the modulation of the catalytic function. This gene encodes one of the nuclear-encoded subunits. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the COX8A gene was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart in sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].