| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUUGGCUUCCUGACCUUGGGCUACGGCUGACCGUUUUUUGUGGUGUA… | 494 nt | 0.5789 |
The protein encoded by this gene is the terminal enzyme of the respiratory chain, coupling the transfer of electrons from cytochrome c to molecular oxygen, with the concomitant production of a proton electrochemical gradient across the inner mitochondrial membrane. In addition to 3 mitochondrially encoded subunits, which perform the catalytic function, the eukaryotic enzyme contains nuclear-encoded smaller subunits, ranging in number from 4 in some organisms to 10 in mammals. It has been proposed that nuclear-encoded subunits may be involved in the modulation of the catalytic function. This gene encodes one of the nuclear-encoded subunits. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the COX8A gene was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart in sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].