Basic Information

Symbol
COXFA4
RNA class
mRNA
Alias
Cytochrome C Oxidase Associated Subunit FA4 NADH-Ubiquinone Oxidoreductase MLRQ Subunit NDUFA4 Mitochondrial Complex Associated MRCAF1 MISTR1 CI-9k MLRQ NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 4, 9kDa Mitochondrial Respiratory Chain Associated Factor 1 Cytochrome C Oxidase Subunit NDUFA4 Cytochrome C Oxidase Subunit FA4 Mitochondrial Stress Response 1 Complex I 9kDa Subunit Complex I-MLRQ CI-MLRQ NDUFA4 NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 4 (9kD, MLRQ) NADH Dehydrogenase [Ubiquinone] 1 Alpha Subcomplex Subunit 4 MC4DN21 COXFA4
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002489.4
Sequence length
2035.0 nt
GC content
0.3936

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-537.00 kcal/mol
Thermodynamic ensemble
Free energy: -578.82 kcal/mol
Frequency: 0.0000
Diversity: 615.29
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((...((((((.((((((((((((....((((((..((((.(((((((..((.(((...(((((.........)))))...)))))....(((((((.(((((..(((.(((((((....((((((.((..((((((.......(((...((((((((((...(((((((...((((..((...))..)))).((((((((.(((....)))))))))))((((((((((.........((((....))))..........))))))))))........))))))).)))))))))).)))......))))))......(((...)))....(((((((.(...((((.......))))...)))))))).((((((.(((((...((((............(((((.........)))))........(((((...(((((....)))))))))).....(((((((((((((...))))))))))))).....(((((..............)))))..((((((.......((((((..(((((.((((.((.((((((((..........((((((.((((....((((...))))....))))))))))..........)))))))).((((((.(((...((.(((((..((((((((.(.((.(((((......))))))))))))))))....))))).)).......))).))))))..)).)).)).))))).)))))).))))))))))....)))))))))))))))))))....))))))).)))..)).)))((((((.((((..(((...((((..((((......))))))))...)))..)))).))))))((((((((....))))))))........(((.....)))((((((....))))))((((((((((((..((....)).))))))))))))(((((((((((.(((((((((....((..((((...................)))).))..)))).))))).(((((.((.((((.((.........((((((((..(((((.........)))))..))))))))))))))))))))).....))).))))))))...)))))))))))))).)))))))))).....(((((((((..(((((..((((....((.((.(((((((.(((((.(((((....))))).)).)))..((((((((.(((((((((((((....)))))).....(((....)))..((((((.......))))))(((((....)))))..(((.....)))............((((((((....((((((((...((.((((((((.....)).)))))))).)))))))).(((((((((...........))))))))).((((....))))....(((((...(((((((((.(((((..(((..(((......(((((..((((.((((((.((.((((.(((.(((.((.(((((...))))).)).)))..))))))).)).))))))..)))))))))......)))..)))....))))))))).))))).)))))....(((((((.(((((.((((.....((((.(((..((((...........)))).))).))))......)))))))))....(((((((....)))))))...((((((((((...(((.....)))..))).))))))).....((((.(....((((((........))))))).)))).((((......))))......))))))).........)))))).)))))..)))).))))))))((((((....))))))......))))))).)).)).....))))..)))))..)))))))))........((((((...........))))))......(((((........))))).)))).))))).)))...))))))....))))).......(((((.(((....)))))))).
Thermodynamic Ensemble Prediction
(({,((...((((((.((((((((((((....((((((..((((.(((((((..((,(((...(((((.........))))),,.}})))||..,,,{(({,{((({{{({..,||||{|||...{{,{{.||.,,||||||||,..............,.,|||..|||||||.{||||||{,,.,{{{{,{{{..((((((((.(((....})))))))))){{((((((((.........((((....))))..........))))))))}}...,,,,,,((({{..(((((...{(({{,,,,||,,..}}}}|,|..|||||,,||..,,((({,,,.|}},|{{{.......}}}}.,,}}}}}}}}.{{{||{,||||{...||{,.,,,,,,.....(((((.........))))}....,,,,({{{{...(((((....)))))})))),....{((((((((((((...))))))))))))),....,{{{,......,,}}}.,,}})}}..|{|||{,{{{{..,,,,,|}}||((((((((((...}))))))))},......,{{((,.((((,({,((({...)))),)),))))||||||((((,,,,,,{{}}}}||,|||{..{(({{{{{{.((((({((((((({(,(,{({((((,..,,{{}||||,}}}}}}}}},....}}}},.}},...,,.|{{...,))}..}}}}}}}}..,,,}})))))),))}}}},})),,,,))))}}||,,|{{|,,,},}}},,,))}||||||||}}.,,||||,|},||||,.,||,},||||}.||||.,,...,)))))}}}}}))),|}|}},,,},,||{{{|||{.,.,)})))))}}.,.,..|{({.....})}|{(({{{{{{.||}||((((((((((((..{{....)}.)))))))))))}{|||{||||||.(((((((((...,(((.,,.....................)))).}}..}))).))))).(((({{((.((((.((.........((((((((..(((({.........)))))..))))))))}}))))))))))).....)}}})))))))),}}}}},})}))))))).)))))))))}.....(((((((((..(((((..((((....((.{{.(((((((.(((((.(((((....))))).)),}))..((((((((.(((((((((((((....)))))}.....(((..,,|||..((((((.......)))))){({{|....}}))).,(({.,...|||....,,....,,|{(((({|....((((((((...{(.((((((((.....)).))))))}).)))))))).{((((((((.,.........}}}}}}}}}.,{{{....}}|},,{......}}}{|||(((({.{{{{{.{((({{(({,{{{.{(((({,{(({{.{(((((.((.((((.(((.({{.{,.(((({...})))).,}.}}}..))))))).)}.)))))}.,))))}))}}.,...,}}}.{|||....,,,,))))),)})))}}}}}}})})}||||||}|((((,((((,..,,((((.(((..((((...........)))).))).))))......)})}})}},....(((((({....}))))))..,(((((,,{{,...,{|...}})))}.|||||,,|||||....((((.{....((((((........))))))}.)))).||||}.....}))),..,,,))))))),,}},,...}))))).,}))),.,))).))))))))((((((....))))))......))))))).}}.)).....))))..)))))..)))))))))...,,,..{{{{({,,,........}}}}}),,,,..{((((........))))).)))).))))),}))...))))))....))))).......(((((.{{{....,}}))))).

Transcripts

ID Sequence Length GC content
GGAAGUCCGUAGUGUCUCAUUGCAGAUAAUUUUUAGCUUAGGGCCUGGU… 2035 nt 0.3936
Summary

The protein encoded by this gene belongs to the complex I 9kDa subunit family. Mammalian complex I of mitochondrial respiratory chain is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the COXFA4 as a mitochondrial gene overexpressed in sepsis patients compared to healthy controls, where lower expression was associated with significantly higher 28-day survival rates and demonstrated high diagnostic accuracy with an AUC of 0.988 [Li et al. DOI:10.1186/s12920-024-01891-x]. In a review of mouse models of myocardial infarction, the COXFA4 was identified as a marker enriched in a high-energy metabolic ventricular cardiomyocyte cluster [Bian et al. DOI:10.3892/mmr.2025.13680].