| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCCGCCUUGCGAGCUCAGAGUGUGCCCGCUGCGCCGCCGCUGUCC… | 738 nt | 0.5718 |
This gene encodes a specific binding protein for a vitamin A family member and is thought to play an important role in retinoic acid-mediated differentiation and proliferation processes. It is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. [provided by RefSeq, Jul 2008]
A study in human skin wound healing identified the CRABP1 as a marker for hair follicle-adjacent fibroblast clusters within the dermis using spatial transcriptomic sequencing [Liu et al. DOI:10.1016/j.stem.2024.11.013].