Basic Information

Symbol
CRH
RNA class
mRNA
Alias
Corticotropin Releasing Hormone CRF Corticotropin-Releasing Factor Corticoliberin CRH1 Corticotropin-Releasing Hormone
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000756.4
Sequence length
1288.0 nt
GC content
0.5357

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-468.00 kcal/mol
Thermodynamic ensemble
Free energy: -487.23 kcal/mol
Frequency: 0.0000
Diversity: 313.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((.(((...)))..))))).(((((((((((((((.(.(((((((((.....((((((((((...((.....((((((........((((.(.(......)).)))).((((((((....))))))))...((((.((.((..((.(((...)))..))..)))).))))........(((((((((.((((((((.(.(.(((((.(.((.(((.(((((((...((((((((.......)))))))).....))))))).))).)).).)(((.(((((((....)))).))).)))...((..(((((.....)))))..))..)))).).)))))))))....)))))))))((..(((((((((((.((((.....))))))))....((((((.....)))))).(((.....))).)))))))..))))))))....)).))).)))).)))....((((((((((((((.((.....((.(.((((.(((...............))).)))).).)).)).)))))))))))))).((((((.(.(((.((((....)))).))).)))))))..(((((.(((((((.((((((((((((((((....((((((.(((.((((.((((((.((((........)))).))))))...))))....)))))))))....))))))...)))))...)))))((.((.(((.......))).)).))....((((((....((((((((...(...((((((((((((.....((............)).....))))..................(((((....)))))..((((.(((.(((((...(..(((.((((((((((.......))))).))))).)))..)...))))))))))))............((.(((((...(((....))))))))))((((......))))...))))))))...)...)))))))))))))).))))))).))))).((((((((((((..((((((....((((...((.(((((((((......)))))))))))..)))).............((((((..(((.((((((((...)))))))).))).....))))))..))))))..)))))))))))).))))))))).)....((((........)))).)))))))...))))))))....(((((((((((.....(((((((..........)))))))....)))))....))))))...
Thermodynamic Ensemble Prediction
......(((({.(((,,,|,}..|}|||.(((((((((((((({.(.(((((((((.....({((((((({...{{.....((((((........((((.(.(......,}.)))).((((((((....)))))))),..((((.{,{((..((.(((...)))..))..}))}.))))........(((((((((.((((((((.(.(.(((((.{.((.(((.(((((((...((((((((.......)))))))).....))))))).))).)).)}}(((.(((((((....)))).))).)))...((..{((((.....)))))..))..)))).).)))))))))....)))))))))((..(((((((,{{{.{(((.{{.{|},|||||....||||}|..}}}),)))..(((.....))).)))))))..)))))))).},,}},)}).))))}})}(((,{(((((((((((((.((...,{((,{.{{,,|{(|,..,|,.........})},})}},}.}}.)).))))))))))))))}||((((,(.(({.((({,,,,}}}}.})).)))))))}}|((({.{{,{((({((((((((((((((((....((((((.(((.((((.((((((.((((........)))).))))))...))))....)))))))))....))))))...)))))...))))))|,{{,{((...,,..))).|},}}..,.((((((....((((((((...{...((((((((({(({{,{{(,.....,,,,{,{{|,,,,.}},................,,,|{|||.,,,))}},}}},|}}||{,((({{,{{,..,,{{(((((,,,,|.,.,,,.}}},,})))))|}||,.|{{{|,}}},,))}.,..}}}},.....((.(((((...(((....)))))))))),{{{,,....}))}...))))))))...)...)))))))))))))).))))))}.}}))).((((((((((((..(({(((,...((((...{{.(((((((((......)))))))))}}..)))}...,,,...,,,.((((((..{((.((((((((...)))))))).)}).,...))))))..}))}}}..)))))))))))).))))))))).)...,,|||.,,,....,,,}.)))))))...))))))))..,||{|{{,(((((.....(((((({.......,,.))))))}....)))))..,.)))}),...

Transcripts

ID Sequence Length GC content
GAGAAACUCAGAGACCAAGUCCAUUGAGAGACUGAGGGGAAAGAGAGGA… 1288 nt 0.5357
Summary

This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]

Forensic Context

No relevant information is available at the moment.