Basic Information

Symbol
CRNN
RNA class
mRNA
Alias
Cornulin SEP53 C1orf10 53 KDa Squamous Epithelial-Induced Stress Protein Squamous Epithelial Heat Shock Protein 53 53 KDa Putative Calcium-Binding Protein 58 KDa Heat Shock Protein Tumor-Related Protein PDRC1 DRC1 Chromosome 1 Open Reading Frame 10
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_016190.3
Sequence length
1902.0 nt
GC content
0.5557

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-653.20 kcal/mol
Thermodynamic ensemble
Free energy: -687.61 kcal/mol
Frequency: 0.0000
Diversity: 545.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((....((((((....(((((((.(((..(((...(((((((((...(((....))).)))))).)))..................((..(((((.(((((....)))((...))..(((((.(((((..((.(((((.((((.((....))))))......((((((((...))))))))(((...((.(((((((......)))))))))))).))))).).)..))))).))))).)).)))))...))((((.(((((((.(((((((...)))))))))))))).))))......((((((((..((.(((((.(.((((.......)))))))))).))(((((((((((..(((((..(((....))))))))))))))..)))))..)))))))).))).))).)))))))....))))))..))))(((((.((((...(((((...((((.....(((.......(((((.....))))).....)))......((((((((((....)))).....)))))).(((((((((.(.((.(((((.(((......)))..))))).))))))))))))..........(((((.(((......))).))))).............((((....))))(((.(((((..(((...(((...((((((((((((..........))).....(((((...(((..((.(((.((((.....)))).).)).)).)))..)))))............((((((((((.((....((((...((.((....(..((........))..)..)).))..)))).....)).)).))))..)).))........((..(((((((((..((((..(((....))).)))).....(.(((((....(((......)))...))))).).(((.......))).....(((((...(((((((((((.((...((..((........))..)).)).))..((.......))(((((..(..((.......)))..)))))....)))))))))..(((....))).((((((((.(((((((....(((......)))...(((((.(..(((.....)))..).)))))..((((.............)))).((((.(....)))))........(((.....)))...))))))).)))..)))))......((.(((......))).)).((((((((......((((((.(((..(((..((((......))))..((.(((((((((((((((((((..(((((.((.((......))))(((((((((..(((((((.(((..........)))...(.((((((.((((.((((.(((.((.(..((((((((((((.(((((((((..(((((..((((....))))....)))))((((((((.(.((.((((.........)))).))).).)).))))))))).)))))((((....)))))).))))..))))))..))).))).))))..)))).)))))).).((((((((....(((.(....(.((((((......(((((((((...))).)))))))))))).)...).)))))))))))..))))))).)))))))))...((((.((((....((((...)))).....)))).)))).)).)))..)))))...))))))).....((((((((..(((....)))......))))))))..))))))).))..)))..)))...))))))..))).)))))....))))))))))))))..))....)))))))))...))).))).)))))...))).)))))))))..........))))...)).))).
Thermodynamic Ensemble Prediction
.,{(((,...((((((....(((((((.(((..(((.,,(((((((({,,,{{{....}},.)))))).|||,..,{{,....,.....{{{..{{{{{,(((((....|||{(,.,||..(((((.(((((..{|.(((((,((((.((...,)})))),....{((((((((...})))))))|{{...((.(((((((......)))))))))})}.))))).}.}..))))).))))),)),)))),...)){(((.{((((({.(((((((...)))))))})))))).))))......{{((((((,{((.((((,,(.({((.......}}))))}))|,||||||,||||||},||||}}}{{{,},,))),))),))))))}}))))}.,))))))),.))).))).)))))))....))))))..,))},|||{..{(({,.(((((,..{(((,..,.(((.......(((((.....)))))....||||......((((((((({....}))).,,.,)})))).(((((((((.(.((.(((((.(((......)))..))))).))))))))))))..........(((((.(((......))).))))).......|{.,.,((((....)))),|,.{||{{{{{,..,,,,,...,,{((((({(((,{((({{,..,|{.,,{.{(,({,..{.|..({,,{{,((((.....)))).).))})}.|||{.|||(|...|)}}}.}}}|{{,((((((.((..,.((((...((.((....|..((........))..}..)).))..)))).,...)).))}})))..,}.,|.....,,,{(..(((((((((..((((..(((....))).)))).,,,.(.(((((.,..(((......)))...))))).).(((.......))).....((({(...(((((((((((.((...((..((........))..)).)).))..({.......))(((((..{..((.......)),..)))))....)))))))))..(((....))).((((((((.(((((((.,..(((......)))...{{{{(.{.,({{,....,}}..,.)))))..{{,{,,{,...,||...||}|.{(((.(....}))))........(((.....)))...))))))).)))..)))))..,,.,((.(((......))).}|,{({{{,{{{{.,..((((((.(((..(((.,((((.....,))})..((.((((((({(((((((((((,((({{,,{{.||,,{{.,{||,(((((((((..((((((({((({..,.....{|||{{.{.((((((.((((.((((.(((.((.{..((((((((({((,(({{(((((..(((((..{{((.,..)))}....)))))((((({({.|.{{.||{{,.,,.,,}.)))).))}.,..).)}})))})).)))}){(({....)))))).})))..))))))..})).))).))))..)))).)))))},,..(.(((((,.{((........)})))))).},,},|{((({{{{...))}.)))))},)}.))))})}..)))))},......))))))).)))))))))...||||.{,||,.,.((({...)))).....}))}.}||||}}}}}},.)))))..,})))))),,,..(((((((({.(((....}}),...,,)))))))),.))))))).))..)))..)))...))))))..)).))))},}))}))))))))))))))..)}....,,,})))))...))))))).,}))).},))).)))))))))..........}})}..,)).)),.

Transcripts

ID Sequence Length GC content
ACUCCUCACACCACUUAACAGCCACUUGUUUCAUCCCACCUGGGCAUUA… 1902 nt 0.5557
Summary

This gene encodes a member of the "fused gene" family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]

Forensic Context

A study in humans demonstrated that the CRNN is abundantly expressed in both saliva and vaginal secretion but exhibits cross-reactivity with menstrual blood [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. Another human study identified the CRNN during discovery for vaginal fluid identification but found it lacked adequate sensitivity, specificity, and robustness for reliable forensic application [Brown et al. DOI:10.1021/acs.jproteome.5c00711]. A study in humans demonstrated that cornulin serves as a biomarker for identifying vaginal fluid in forensic traces, where it was detected alongside cornifin and involucrin [Van Steendam et al. DOI:10.1007/s00414-012-0747-x].