| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCUCACACCACUUAACAGCCACUUGUUUCAUCCCACCUGGGCAUUA… | 1902 nt | 0.5557 |
This gene encodes a member of the "fused gene" family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]
A study in humans demonstrated that the CRNN is abundantly expressed in both saliva and vaginal secretion but exhibits cross-reactivity with menstrual blood [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. Another human study identified the CRNN during discovery for vaginal fluid identification but found it lacked adequate sensitivity, specificity, and robustness for reliable forensic application [Brown et al. DOI:10.1021/acs.jproteome.5c00711]. A study in humans demonstrated that cornulin serves as a biomarker for identifying vaginal fluid in forensic traces, where it was detected alongside cornifin and involucrin [Van Steendam et al. DOI:10.1007/s00414-012-0747-x].