| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGUGCGGAGACUGAGGUUAGAAGGCACAGGUGGCGAGAUGAGCCGGG… | 1244 nt | 0.5233 | |
| GCACAAGCUUUCUUGUCUGCCACUAUGUGAGAUAUACCUUUCACCUUCU… | 1482 nt | 0.5189 |
Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
A study in humans identified the CRYM as a gene expression marker that is up-regulated in heart tissue from patients with various structural heart diseases compared to controls, with a mean fold change of 1.7969 and an adjusted p-value of 1.1463 × 10^-24, and it was part of a 62-gene signature that achieved approximately 95% classification accuracy using a random forest model [Fajarda et al. DOI:10.1186/s13040-020-00217-8]. In a separate human study of post-mortem tissues, the CRYM was found to be down-regulated in the hippocampus and kidney as part of the metabolism of amino acids and derivatives pathway in patients who died from septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].