| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUACACAGAGAGAAAGGCUAAAGUUCUCUGGAGGAUGUGGCUGCAGAG… | 788 nt | 0.5025 |
The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. This gene plays a role in promoting tissue inflammation. Elevated levels of cytokines, including the one produced by this gene, have been detected in SARS-CoV-2 infected patients that develop acute respiratory distress syndrome. Mice deficient in this gene or its receptor develop pulmonary alveolar proteinosis. [provided by RefSeq, Aug 2020]
A study in rats demonstrated that the mRNA expression of the CSF2 (CSF2/GM-CSF) showed a statistically significant increase at 1 and 3 days post-skin incision, and it can accelerate wound healing by promoting angiogenesis [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007].