Basic Information

Symbol
CSF2
RNA class
mRNA
Alias
Colony Stimulating Factor 2 GMCSF Sargramostim GM-CSF Colony Stimulating Factor 2 (Granulocyte-Macrophage) Granulocyte-Macrophage Colony-Stimulating Factor Molgramostim Molgramostin CSF Granulocyte-Macrophage Colony Stimulating Factor Granulocyte Macrophage-Colony Stimulating Factor Colony-Stimulating Factor
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000758.4
Sequence length
788.0 nt
GC content
0.5025

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-268.70 kcal/mol
Thermodynamic ensemble
Free energy: -281.32 kcal/mol
Frequency: 0.0000
Diversity: 155.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((..(((((((...........)))))))(((...((((.(((((((..((((((....((((......)))))))))).))))))).))))...)))(((((.((((........(((((..((((..((((.((((..((.(.((((((((((.((((((.....(((...(((((......(((((((((...............)))))))))...)))))...))))))))).)).))(((.(((((..((....))..)))))...))))))))).)))))))...))))...)))).)))))((((...(((.((((((((.((...(((((((((((.....(((......)))........))))...................((((((((...((.....))...)))))))))))))))..((((((((.(((.(((((......))))).))).)))..((((((......)))))).....))))).(((((((...........))))).)).......)).)))))))).))))))).....)))))))))....((((((((.((.(((((((((.......))))))))).)).))((((...)))))))))).(((((((((((((((....((((((......)))))).....((((....))))......(((((..((......))..)))))......))))))).))))).)))((((((((((...(((((....)))))..))))))).))).))))..
Thermodynamic Ensemble Prediction
((((..(((((({...........)))))))(((...((((.(((((((..((((((....((((......)))))))))).))))))).))))...)))(((((.((((........(((((..((((.{((((.((((..((.(.((((((((((,((((((.....{{{..,||||{.,....(((((((((.,.............)))))))))...|||||..,|||||||}}.}}.}|(({.{{{{{..((.,..)).,}}))}...))))))))).)))))))...)))}.}.)))).)))))((((...(((.((((((((.((...{(((((((.,..{.{,({{......|||....,||,|,|,....|||.....,..(((((({...})))))).,...,}}.,)).}.,,)))))))},.((((({((.(((.(((({......))))).))).))}..(((({{....,,)))))).....))))).{{(((((...........))))).}}.......)).)))))))).))))))).....)))))))))....((((((((.((.(((((((((......,)}))))))).)).))((((...)))))))))).(((((((((((((((....((((((......)))))),,{..{{,{{{{,||,,....,,|||||,.||..,|,,||..,,,.}}},,..))))))).))))).))){(((((((((...{((((,...,)))),,))))))).))}.))))..

Transcripts

ID Sequence Length GC content
AGUACACAGAGAGAAAGGCUAAAGUUCUCUGGAGGAUGUGGCUGCAGAG… 788 nt 0.5025
Summary

The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. This gene plays a role in promoting tissue inflammation. Elevated levels of cytokines, including the one produced by this gene, have been detected in SARS-CoV-2 infected patients that develop acute respiratory distress syndrome. Mice deficient in this gene or its receptor develop pulmonary alveolar proteinosis. [provided by RefSeq, Aug 2020]

Forensic Context

A study in rats demonstrated that the mRNA expression of the CSF2 (CSF2/GM-CSF) showed a statistically significant increase at 1 and 3 days post-skin incision, and it can accelerate wound healing by promoting angiogenesis [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007].