Basic Information

Symbol
ADGRV1
RNA class
mRNA
Alias
Adhesion G Protein-Coupled Receptor V1 VLGR1 KIAA0686 GPR98 MASS1 FEB4 Monogenic Audiogenic Seizure Susceptibility Protein 1 Homolog Very Large G-Protein Coupled Receptor 1 Adhesion G-Protein Coupled Receptor V1 Usher Syndrome Type-2C Protein G-Protein Coupled Receptor 98 DKFZp761P0710 USH2C Monogenic, Audiogenic Seizure Susceptibility 1 Homolog (Mouse) G Protein-Coupled Receptor 98 EC 3.4.-.- KIAA1943 VLGR1b USH2B
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Postmortem interval inference

MANE select

Transcript ID
NM_032119.4
Sequence length
19557.0 nt
GC content
0.4249

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-5776.30 kcal/mol
Thermodynamic ensemble
Free energy: -6152.76 kcal/mol
Frequency: 5.26463e-266
Diversity: 4915.29
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((..(((((((((((((((...(((((((....((((((....(((((((((((((((((((((((((...(..((.((.((((((((((.((.....))))))))))))))))..)...)))))))))))......(((((((((((.((((..(((((..(((.......)))..))))).....)))).)))))))))))....(((((.(((((((........)))))))....))))).(((.(((((((........))))))))))...((((.(((....))).))))....((((((((..(((.(.(((((((.((.((.....((((((((((......((((((((..(......)...)))....)))))....))))))))))..)).)).))))))).))))..)((((........))))......)).)))))..)))))).(((((((((((((((((....)))))(((((((..((((((((((....((((((......))))))(((....)))......(((.((((((((...((((((..(((..(((..((((........))))....(((((.(((.(((((((((.(((((..((((((....(((.((((((.........(((((((((((..((((((...........)))))).(.((((..(((((........)))))....)))))(((((((((((..........((((.((...(((((((...(((.(((((......((((.((....)).))))(((....)))........((((((((((..(((...(((((((((((.(((.(.(((.((((((......)))))).)))).))).)))))))..))))...)))))))))))))(((............)))....(((((((.((((.......)))).))..)))))..((((((((((((.((....)).))).)))))))))...(((((.((...(((((....)).)))....))..)))))...))))))))))))))).)))))).........))))))))))).)))))))))))((((.(((.....((((....))))...))).)))))))))))))(((((((.(((((....))))...............(((((((....((((.(((((...(((....)))((.((((..(((((..(((((.......((((.....((((((((((((((((((((..(((......).))..)))))))))..(((((.((((((.........))))))..))))).((((..(((((.((..(((((((((((..(((.(((...((((((((..(((((((((((........))))))(((....))))))))....))))).....)))....))))))..)))))))))))..))((((((..((((((.((((((((((((....(.(((..(((....)))..))).).(((((((((................))))))))).........)))))((.((((((((..((......))...)))))))).))..(((((((((((.((..((((((((((............((((((...))))))((((..((((((.((.((((((.(((...((.(((((....))))).))...(((((.((((((((...(((((.((((((((.((........)))))))))))))))(((((((....(((..((((...........))))..)))............(((((((((....))))))))).(((.......)))................((((..((((((((.(((((((((.((((.(((.(((.(((....)))((((((...))))))((((((((.....))))))))................))).)))..)))))))))...)))).))))))))...))))..)))))))(((.((((((((((..((((.((.....)))))).))))).....))))))))....((.((((((((((.((((((((((((.((((((........))))))..((((..(((((.(((((((.((..((((..((((((((....))))))))))))..)))))))..(((((((((.(((((((........))).)))).......)))))))))..((((.((((((((.....(((((((......))))))).....(((....(((..(((.((((((..((((((((((((..((((.........))))..))..((((.(((((...((((..(((((.....(((((((....)))))))......(((((((((....)))))))))((((((.(((.(((((((.((...........((((..((....)).))))............))..))))))).)))..)))))).((((((........))))))(((..(((...........))).)))...))))).))))))))).))))...))))))))))((...((((..(((((((.((.(((((((.(((((((...(((((((.(......)))).)))).((((((((((.((((.((.....))))...(((.(((((((...(((((((((((.......)))))........((((......))))(((((((((((...(((((((..((.(....((((....)))).....).))..)))))))...)))))))))))...(((((((((.(((.(.(((((((...)))))))..).))).)))))))))))))))...)))......((((.....)))).((((((....((((((....))))))......)))))).............((.((((((.((((..(((((.((..((((.((.((.(((((.........)))))...)).))))))..)))))))))))...)))))))).......)))))))..))))))))))))..............)))))))))))))).((((((((.....))).))))))).))))))).))))))....))))))))))))....)))...))))).))).)))))).)))))))))......(((..((((((((((((.((.((((((.(((.(.((((..((((........))))))))).))).))))))))(((.(((((.((((((...((((.((((....(((((((...(((((.((((((((..(((..........((((((((((.((((..(((...((((((.(((.(((((...((......))...))))).)))...((((((((((.((((..((((...(.(((..(((((((((.((((...(((.........((((((((.....((((......))))(((((.((...((.(((((.(.(((((((((((((....((((..(((((((.......(((((((.........(((((((((((((((..((((..((((((((.((((........(.((((((((((...........)).)))))))).).......))))...))))))))))))..)))))))............(((((..(..((((((((((.((((((...))))))((......))....((((.((((((((....(((((((.(((((((...((.(.((((.((((......((((..((((((((..(((((..(((((.((((((((((......(((((..(((((.(((((((...)))))))....))))).(((((((......))))))).(((((((((.((((((((((((.((......)))))))))..((((((((.((((.((((((((.(((........))).))))(((........))).....((((..........))))....))))..))))))).)))))........))))).)))))))))..(((((((..((((((........))))))....)).)))))))))).........))))).)))))...))))).((((((((...)))))).)).)))))...))))))))..)))))))))))).)))..))))))).))).))))..(((((..................)))))(((((.((....(((................)))......)).))))).......((.(((....))).))..(((.((((.(((((((.....))))..))).)))).))))))))))).))))..........))))))))))..)...)))))))))))))))))))))))).)))..)))))))).))))))))).)))))).))...)).)))))..((((((((....((((((....((((((....))))))....(((((.....)))))..(((((........)))))((((...........)))).))))))((((.......(((.....))).((((((((((.......((((((...((...((((((((.....(((((..((((((((...)))))))).))))).....((((((((......))).)))))....)))))))).....))...))))))(((((((....).))))))((((.....................))))...(((((...(((((.(.((....)).).)))))))))).)))))))))).......(((.(((.(((.(((((((((((((((...(((......(((((((((...((.....((((((....((.((((((((..((((........(((((((......))))))).(((((....((((((.((((............)))))))))).....)))))((((.((((((.(((..........)))))))))..)))).((((((((.((((((((.(.((..((...(((((((((((((((.(((((((((.......(((((((..(.((((((.........((((....)))).....(((((.((.(((((.(((((((((......))).))))))(((((.((......(((((((((.((((.......)))).)))..).)))))...))..))))).(((((((......)))))))......))))).)).)))))......((((((((.(.(.((((....))))).).))))))))..((((...((((..((((((((..(((((((((((((...)))))....))))))))((((................))))(((((.............))))).....((((((((....((((((((((((..........((((((.(((((.........))))).))))))(((((......))))))))))...)))))))....))))))))..))))))))....))))...))))..............)))))).).))))))))))))))))..)))))).))..)))))))))..)).)))))((((.(((.............))).))))(((((((...(((((...)))))..((((((.(((((((((....((..(((...(((((....))))).)))..))(((((.(((((((......)))))))..)))))((((..((((...(((..((((((((((...((.(((((.(((.(((.(((.(((((((......)).))))).)))..)))..))).))))).)).))))..((((((((((((..((((((...((((..(((.(((((.....((...))....))))).)))))))..))))))..)))..)))))))))((((((.((...(((((((((((...(((((((((......((((....)))).....(((((...(((((.........................))))).....))))).)))))))))...))))))))))))).))))))......(((((((.........))))))).........))))))...)))..)))))))).)))))).))).))))))((((.(((((....))))).)))))))))))(((.......)))(((((((((((..((((.(((((..(((((.(((((....((((((((...((((.((((.(((((((....))))....)))...)))).))))..((((((.(((((((.((((((.((...((.......))...)).))....(((((((((...))))))))).....((((....))))((((.(((((((((((((.....((((......(((((((((........))))))))).....((((...((((.((((((((....))))))))))))....))))))))......)))))..(((((((((.((((...))))))))))))).(((((..(((...((..((((((((.(((..(((((((......((((.(((((((((.(((.(((......)))))))))..(((((.((((((((.((.......)).)))..((((((((((((((((..(((.(((((((..(((.......))).))))))).))))))))).).....)))))))))................))))).))))).((((((...))))))....((((....))))............(((((((((.(((((.(((((((.((((((((((....)))).......(((((((((((............))))))))))).((((......))))...((((((.((((.........(((((.......)))))((((((.((.(((((((.................((((((((((((((((((.((((((((...)))))))....).))))))......))))....(((((((((......))))))))).....((((((((.(((.(((..(((((.(((((...........))))))))))..))).))).)))))))).......((((((((....((((((..(((.(((.((((....))))..))).))).)))))).(((((...))))))).))))))((((((((.(((........))).)))).))))...(((((((....((((((.....)))).)))))))))))))))))))))))))).)))).)).(((((..((((..((((.(.((((((((.(((((...(((((((.(((...((((...(((((......((((...((((((((((((((..((((((((((.((((((.(((.((((((((((.........)))(((((......)))))...((((((((((((......))).......))))))...))))))))))..)))))))))((((......))))(((((((.((..((.(((...((((.....))))...)))))..))))))))).(((((((((...((((((((((((...(((((((((((..(((.......)))(((((.....))))).((((((.....)))))).....(((........((((((..............))))))..((((((...(((((((((((((((((((((.(.((.(((......)))))).))))).))))))).((((((..(((((((.((.(((((((.(((((...(((..(((...(....)...))))))....))))).))))..(((((((((.........((((..(((((((((((((..((.((((....))))........((.(((((.(((((((((.(.((((((...((((..((((((..(((.((((((.....((((...)))).(((((...)))))))))))((.....))...)))..))))))...))))...)))))).)))))))))).)).))).))(((((...((((((((....(((((((.(((((..(((((((((..(((..((((.......))))..))).))))))))).)))))...)).............(((((..(((((..((((((((........))))).)))..)))))..)))))....((((((............))))))(((((((....)))))))..((((((.((((((.((((((.((((.(..(((((.(((....)))..)))))..)..)))))))))).)))))).))))))...)))))))))))))...).))))........))..)))))))))))..))..))))))))))))).((((((((...((((.((((((((.(((((..(((((((.(((((..(((((.((((((...((((((.............((((((((((......)).))))))))..((((((.(((((.......))))).)))))).((((((((((....((((...)))).....)))))))))).(((((....((......))..)))))..((((((.((...((((..(((((((((((.((((((((((((((((((((.(((((.....(((((((.((.(((((((((..((((((((........)).))))))..........(((......)))..(((((.((((((....)))))).))))))))))))))....))...))))))).....))))).)))))))...(((((.....)))))........)))))))))))))..)))))).)))))...))))......))))))))..)))))))))))))))))...))))).))))))).(((.(((((.........))))).))).......((((((((((((.(.(.........).).))))))))))))((((((((((((((............((((((((.....)))))))))))))))))..((((((.(((((.......))))).))))))))))).((((..((.((((((......))))))..))..))))(((((((((((((((((((((.......((.((((................)))).)).......))))..)))))))(((((.......))))).............(((((((.....)))))))..))))))))))(((..((.(.(((((.((((((((.(((.(((.....)))....))).))))))))))))).).)).)))((((((((((((...((((((......((((.((((((((((.(((((..(((((......)))))....))))).))...(((.((((((.((((.....(((((((........(((((.(((.(((((((((.......((((((((((((((......)))..))))))).))))..(((((..........)))))((.((((.....(((...(((..(((((((((((((.(((((((((((((..........)))))((((..((((..((((((((...((((.(((...((.((((......))))..))..))).)))).....))))).)))..))).)..))))......))).)))))..)))))....)).))))))..))).)))..)))).))....(((((((((.....(((...(((((((...)))))))...)))..)))))))))...(((((((........))))))).....))))))))).))).)).))))))))))(((((....)))))((((.(((((((.........)))))))..)))))))).)))))).)))...(((((((((.(((.((((((((....))))))))..))....).))))))))).........(((((((........)))).)))...............((((.......))))..((((.((((...(((((((((((....)))))))..(((...(((((((....)))).)))...)))...))))...)))))))).....)))))))).))))......))))))))))).)))))))........(((.((((((((.((((((((..((((((((((...)))))).(((((((......((((((........))))))((((((((((..................))))))))))((.((((((((((...((((((((((...((((.((((.(((....(((((.((((........))))...((((((.....))))))....(((((((((..(...(((........))).)..)))))))))..((((..(((((((((((((((((((((.......((((..(((.....))).)))).....((((((.((((((......((((.((.......(((((....(((((..(((((((....((.((((((((((.((..(((.(((..((((.......((((((((((..(((((((.(.....(((((.....((((((((((.((..(((((((((....(((((......))))).....(((...((((((((((((..........)))))))..)))))......)))......)))))))))((..(((((((((......)))))))))..))...)).))))))))))..)))))....((((......)))).).)))))))))))).)))))........))))........))).))).)))))))))))).))))))..((((((((((((((((((..((((...(((.......)))....)))).))))))))........)))).))))))......)))..)))))...))).))......(((((....((((...(((...))).....))))....)).))).......((((...)))))).))))..((((((((.......))))))))......)))))))))))).....)))))))..))).)))))).((((((((..........(((.((((((((........)))))))))))..))))))))...((((((((.(.((......))).))).)))))(((........)))....)))))..))))((((((......))))))....)))))))))))).)))).)))))))))).)))))))))).))..(((((.((((.......)))))))))))))))).............))))...))))).....))).)))).))))..))))))))))))))))))))...)).))))))...................))).)).)))))))..)))))).((((........((((((.((..........................)).))))))......))))(.((((((((((((....((((((...(((((((.......))))))).......((((...(((((.(((....))))))))....))))....((((((((((((......(.(((....))).).........))))(((..((((.(.(.((((((..(.........)..)))))).).).))))..).)).((((((((.(((.(((....))).)))....))))))))....((((((.....)))))).))))))))))))))....)))))))))))).)((((((....))))))....)))))))))...))))))))).)))))))))))...))))))).)))))((((.....((((((.(((.....)))))))))....))))(((((((((((((.((((((......(((((.(...((((((((.....(((((((.(.((.(((..(((((((((((((((.(((((((.((.((((((((((....))))..)))))).)).)))((((....)))).....((((..........((((((((((....(((((((....((((...))))....)))))))......)))).))))))))))((((((((((.(((..........)))..)))).).)))))....((..(((((((((........)))).)))))..))((((((.(((((....)))))...).))))).....))))..)).)))).))).)))).))..))).)).).)))))))...)))))))).).)))))((((......((((..((((((....))))))))))......)))))))))).)))))))....)))))).......)))))))))......(((....)))))))))))))........)))))))).))))))))))......)))))...)))).....))).)))))))))))).)))))....))).).)))).)))).)))))(((((......))))))))).))))))..(((.((((....)))).)))..((((..(((.((((.....)))))))))))(((((....)))))....)))))).))))))).))))).....((((((....))))))...(((((((....)))))))((((((((((((((((((..((((...((((((........))))))(((((.............))))).....(((((.((((.((.......((..((((((((.(((((...((((((......((((.((((......)))))))))))))).)))))...))))))))..)).(((.((((((((((((...((((((((...(((..(((((((..((((((......))))))..)))))))....)))...)))))))).)))))...))))......((((((((.(((((..((((((((...))))))..............(((....))).....(((((((......)))).)))........)).)))))))))).)))...(((((...)))))(((((((((....((((((((((...........)))))......(((((((..((....((((...))))..))..)))))))...))))))).)))))))..))).))).......)))))).)))))(((((((..(....).)))))))...))))..))))...))))))))))))))....)))))))))..)))))).))))...)))))))..)))(((((((((..(((((((((....(((((((((..............((((((....))))))....)))))))))..))))))....(((((.((((((((.((..((.(((((....))))).)).))...)))))))).))))).......)))))).))))))((((....))))......))))))))..))..(((((........))))).....)))..))))).((((...)))).)))))))))))))))))))))))...))))))......(((.....)))))))))))..)))))....(((((.....((((.((.(..(((((((((......((((.(((.......)))))))))))))))).....).)))))).....))))).......)))))....)).))).))))...)))))))))))....)))).))))))))......))))..)))))))))))))))).....))...)))))))))......)))...)))))))))))))))..)))))))))....(((((..........))))).........((((....))))...(((((((((...))))))))).))))))))))))....)))))))).........)))..)))).))...)))))))..))).)....)))).))))(((((((.......)))))))....(((((((((.((.((((((........)))))).))..))))))))).....)))))))))).((((((((....)))))))).)))))).)))..)))).))))))))))....((((.(((((....))))).))))....)))..)))))....((((((....((((..((((..((((((((((.....((....))..)))))))...)))..))))..))))....))))))...((......))......))))))))...)))))))....((((....))))......)))).)))).))))))..))))).)))...(((((..............)))))((((((((....(((......)))..)))))).))....(((((((((.............)))))))))...........))))))))))))..)))((((.....(((((........)))))....)).))...((.(((((....))))).))))))))......))))))..)))))))))).)))))))))))))))(((((((.........)))))))...((((....))))..((((((((.......(((.((((..((((((....)))).))..)))))))...))))))))))).))).))))).))))))..)))).))).)))))))..)))))..........)))))))).....))))))).))))))..(((((....))))).))))))....((((((...((((((..((...((((((((((.((((.((((((((.((..(((((....((((((((((((.((((........)))).))))))(((((..((((((((((.....))))).)))))...)))))((((((.....(((((..(((((...................)))))............(((((....))))).((((((.((................)).)))))))))))..))))))..........)))))).....)))))..)))))))))).....)))).))))))))))...))))))))...)))))))))))..))))......))))...)))))))...))))............((((((.......((((........))))........))))))(((((.(((....)))..))))).......(((((((..(((((....(((((((((((((((.......))))).))(((((((....((((((.(((((((((((.((((((.((((.(((....))))))).......(((..((((.((.((((((((((....(((((.....(((((.........(((((....((((((.((((...................(((((((.......)))))))..))))..))))))....)))))..)))))......)))))....)))))...((((.((((((.....))))))))))..(((......))).))))).)).))))..)))((((....)))).......)))..))).))).)))))))))))))).............(((((...)))))..)))))))..(((((((.....))))))).)))))))).(((((...)))))..)))))....))))))).)))))....))))).)))).))........))))).)))).....)))))))..).))))))).......))))))............((((.((((.....)))).)))).)))))...))))).))))))).))))).........(((((((((((...))))))..)))))..((((((((..((((((.(......).))))))......))))).))))))..)))..)))))))))).)))).))).((((((((((........(((((((((((((.........)))))))......)))))).....)))))))))).....((((.((((........)))).))))(((.((.(((.......))).)).))))))))))))).(((.((((((..(((((((.((.....)))))))))))))))..)))...........)))))))((.((((((.((..((((((......(((.....))).(((((((((((((.((((........)))).....(((((((......(((((.....))))))).))))).(((......)))..))))))))))))).....((((((((...........(((((((((((((((.(((..(((..((((.((.((((((((((((((....))))......))).)))))))....)).))))....)))..)))..))))).....))))))))))))))))))((((((((............)))))))).(((((((((((...(((((..((((.(((......((((((((((.........)).)))))))).....((((...))))....((((((.(((.(((((((..(((.(((..........((((((......))))))))))))..))))))))))(((((...(((((...((((..(((..(((((((((..........((..(((((.((((((......((((..(((((.((((.....))).).)))))..)))))))))).))))).))..........)))))))))(((((((((((.(((((((.......))))))).)))).(((((.(((..(((((.(((..(.((((((....)))))))..)))..)).)))..)))..))))).........(((.((........)).)))......))))))).((((((((((((((.((((((((...........))))))))))))..........))))))))))((((........)))).............)))..))))((((((((((.(((((((((((...)))))))))))................((((((((....))))...)))).)))))))))).............)))))...))))).(((.(((((....))))).)))((((((((.((.(((.............))).)).)))..))))).......))))))..(((((..((((((((((((((.((((..(((((((((((....((((.((((((.....((((.((((((((.....))))))))..)))).(((((...(((((((..((((((((((......))))((((.((.....)).))))..(((((....(((.(..((((((((((...)))).))))))..).)))..)))))..........)))))))))))))(((((.((....((((..((((((....)))))).....))))))))))))))))((((((((((((.((((((((((((.(((...(((...((.(.((.((((((.(((((((((......)))).))))))))))))).).))..))))))..))))))))....)))).........(((((....)))))..(((((((........))).))))....((((((((......................))))))))...(((((..((((........))).)..)))))..)))))))))))).......((((.......))))((((......)))).(((((((((((((..((((((((((((......)))))((((((((..(((((((.((((...(((((((((((((((((....)))))))...))))...)))))).)))).)))))))..)))).)))).(((((((.......))).)))).))))))).))))))))))))).)))))).))))...((((((..(((.........)))..))))))((((((((((((((((((.((((...((((......(((((....)))))......))))...))))..(((((..........)))))...........))))))).))).))))))))..(((((.......)))))....(((.......(((((((((((((((((.(((...))).((((((.(((((.........(((........)))..........))))).))))))..(((.((.((.(((((((((((.(((.......((((.(((..((....))..))).))))......))).))))))).)))))))).)))...))))))))).((((...((((((...(((((......)))))......))))))))))....)))))))).......))))))))))))))))))...)))))))))........))))).)))))(((((....)))))))).))))...))))).)))))))))))...((((((((((..(((((....((((..((((((........)))))).))))((.(((((...(.(((((.......((((.((((.......(((((...)))))..(((...))))))).))))))))).)..))))).))(((((.((.(((((..((((((.(((((((........(((((...((((((((((....))))))))))..))))).....((((((((..(((........))).)))))))).......))))))).))))))..).)))).)))))))...)).)))..)))))))))).......))))))..))))))))))))))))))))))....))))...))))...))))))...)))).))).))))))).((((....)))).....(((..((((((((((...((((..(((((.(((.((((((((((.(((..(((((((.((((((.((((...((((((...........)))))).)))).)))))))))))...))...))).)))))))))).))).)))))))))..))))))))))..))).(((..((((....))))..)))....((((((((((((((((...)))))(((......))))))...))))))))..........((((((..(((.......))).......(((((((..((((....((((...)))))))))))))))......(((.((((((((...(((((....((((..(((((........))))).....))))....))))))))))..))).))).))))))....))))))))....)))))..
Thermodynamic Ensemble Prediction
,,(({(,..(((((((((((((((...(((((((..,.((((((,{{(((({(((({,(((((((.(((((((((((((...))))))(((((((.((,...,))))))))){{((,((((((((((((.,{,({,......(((((((((((.((((.,{((({..({{.......}})..})))),,.,.)))).)))))))))))((,.(((((.(((((((,,......)))))}}....))))}.,}}}}},.....{((((((((((((((((((((((..(((....||}.,,},{((((((((.((((((..(((((((.,,......,.,,{,,,{(({{{.|....,,,,,((({.{{{...,{...{{|{{{.|||||{{,,|||||}||||{{{.,{{.,,..{{{||.,||..((({........))))..,,,.}}}}}}},....(((((......,)))))(((((....))))).}}}))}|.}))||,|{{{.,.{((((((......))))))},,.}}}}||||.||,,|,.(((((((((..,(((((((((({({,...{|||({,......}},.,}}|||,,,,{{(((((((((.,,{((,.(((.{{{,...,,}}}}|||.,}||||..,{..,,|||,.,))}...,}}))))))))),}},..}}},,{.....{(((........)))}{((((((((((((({{,{({{.,.,,,..,{{{,,{,(({((((....)))},}}},,{,,,,{{.,,,,.||,,}}),.|||,|||,...}}|{{((({,{{((((((((({{,{{...{({{(((((((.(((.(.(((.((((((......)))))).)))}.))).)))))))..}||||,,..,},|||||||,.,|},..}}}}.}},}}}....,(((({{,({{{{{{{{,,||||{||{.|||,,..{(({(((({{((,(,,,..||,|||||,}}}}|||,,.(((((.,,...{((((....)),))),...,}.,|||}}....))))}}}}}})}}})).)))))}}|.||,...})))))))})))}),,,}}}}{{{{.(({{{{..{(({....|}}}...}}),)}}}...|.....|)}}}}|((({..((({{{(((.,,.({{.,{{...,,...,|||,{{|,|,,.,,,||{(((((((.((((((,(((,,,.....,,,,{{,,.,{{{{..|{,,...{{....)).(((((((((..(((......}}))..)))))))))..{((({.((((({.........))))))..))))}....||}|...))))}.{(((((((((({{(((.(((...((((((((..(((((((((((........)))))){{,....}}})))))....))))}....,)))....)))))).}))))))))))}||},|}}}))...}}}}}}},.}}.,{((((.,..(|(((..(((....)))..))}.,.(((((((((................))))))))).........))))))}}|||,||}|}}||}}..}})){{{||,,,,))))),{{{{{((((((((((,,.,((((.((((({..,..{{{,((((((...)))))}{((({{{{.,,,{,((((((((,((...,.....,,.(((({.(((({....})))),,))))}.....{|{,.||{||,||}}||}},..,,,}}}|||}}||}||||.,|||{||}}|(({(({{,({(,{({,.,{{{.,|{,|||............(((((((((....))))))))).(((.......)))..((((((.,......{(({.,((((((((.(((({(((,,{{{,.,||,{{{.{{{,,,,}}}{(((({,,.})}))}((((((((.....))))))))................}}|{|}|..}}}))))}}...)))).))))))}}.,.||}}..((((({(,,,.,,..,)))}}....{{((({(,.(((((((((((...{{{{.....}}}}....)))))}..}))))..))}||({{...{{,{{({...,,,,||}},,...))}}})}||||{.{{{{(||{.,||({||((((((((....))))))))})),..,)))))).}(((((((((.(((((((........))).)))}...,,..}))))))))...||||||...,,......(((((((......)))))))..,,.,|{,,..{{{,{{{.,((((,..,((((({{{{{.((((((((.({({{....|||,||,.,,...{{{((.....,},,}||,},.{,,{.,,,|}}))...))).)))))))){{(((({{,,..,,.,|||||(({(((.{{{.{((({{{.,|,,.....,|..||||,,{{....))|)))).,,||,,,,{|.||,{||}}}))})))..,}}}}|.{(((((.,....,.)))))}|{,.{(({{{{{...{{{,|||,||,..{|{|||,|||{||}}},,,,....}}}}}}}}}|{{.,,{{{{..|{{{{|{.{{.(((((({,(((((((...(((((({{(......)))).)))).((((((((((.((((.((.....))))...{{(((((,(((...(((((({{{(({,.....,,}}}.........|||,|,...,}||(((((((((((...{((((((..((.{...,((((....))}),}...}.))..)))))),...))))))))))),,.(((((((((.(((.{.(((((((...)))))))..}.))).)))))))))))))))...))).}})},{{{{.....}))}.{(((({..{.{{((((....)))))}|,,,,.}}}}}),,,,,........((.((((((,((((..(((((.((..((({,((.((,(((((,,....,}.))))).,,}).))))))..))))))))))).,.)))))))}.......,,,)))}..}}))))))))))..............)))))))))))))),(((((((,..,,,|||||,}||||.|||||||.},||||,.,.||||||||{|||,,,,|||..,}}},||||||,|}}|||,||||||{...|||.}|||}}|||||}}}((({(((({.{{(({{,...||}}.,((((........))))}.|||.((({....))))||(({{{{{{{{|{|||||||...,|||,..|{{{{{{{..((,((((((((({{{,....((((((,((((((((((.,(((.((((((((..((((.....(((((({...,{..,,,....(((((.((((....)))).))))).,,,,,..(((((..((((((((((,((.....((((.,......,.))))....}))))))}..}))))..))))).....(({(((((((((...))))))}.}}}))}),,,,,..{(((..((((((((((.((((((({{...}}..(((((((({{(((((..((({..{{((({{{,|,{,........(,(((((((({{...........}}.)))))))).}...,,,|||||{,,|||}}}}}}}))..))))))),,,.........,(({{..{,.((((((((((.((((((...))))))((......))....((((.(((((((({{{.(((((((.(((((((...({.(.(({{(((((......{(((..((((((((..(((((..(((((.((((((((((...,{.(((((..(((((.(({{({{...}}}}}}}.,,.))))}.(((((((......))))))).(((((((((.((((((((((((.((......)})))))))..((((((((.((((.((((,{,,.,{{........}},.||||,((.......,}})}},..((((..........))))....))))..))))))).)))))........))))).)))))))))..(((((((.,((({((,.......)))})),,..)).))))))))))....,....))))),,))))...))))).((((((((...)))))).)).)))))...))))))))..)))))))))))).)}},,))))))).))).)))}..(((((..................)))))..|,(((((((({.,{((..........({{{|,...(((((.......)))))}||}|{{....))}.}}........,},}))))))))}.,},......}.,,..,)}.)))))))).))))..........))))))))))})},,.}))),)))))))))))))))....)))))))))))..))))}))))).....))))(((((,(.{(((((((.((.(((.,..{(((({.,{,((((((....,)))))....(((((.....)))))..(((((........))))){{{{...........}}))})))))),))))).....(((.....)))))))))))),).))))).))))))))..,))}((((((((.....(((((..((((((((...)))))))).)))))...,,{{{(((((......))).)))))....)))))))).)))))))))).)))))).|}}}}}..}}..,)))}}||,{,,.,|}}}}}|,,,,...,,{{(,{.,{((...{.|||||},|{{{{,{{{{{{{{{||,|,|.{{{||{.||||,|{|{{|||||{{|||||,,....,}|||||}}...},|||{|{,,,)})))),}}|||||,},|||....,|,|||||||,.,,,.))}},.,}.}}}||{{{,|,,,,,,,)))),,.}},,||}}.||||||,||||....,,,,,)}})))))),)))....{{{||}}})))}|.,......((((,{{{..{{{{{{.,|,.,|||||..,|}}}|}}}}|||||{.||,,||,|||((((((((((((({.((((((((({..{{{,(((((({.{({(((((,.........((((....)))).....(((((.((.(((((.(((((((((......))).)))))){{{(({({,,,...{{(((|{((.((((,......}))}.))}..}.}}}||,..},..))))},|((((((......)))))))}}},..))))).)).))))),|,..,((((((((.{.(.(((,....})))}.,.))))))))|.(((({{{.{{...((({({..{.(((((((((((((...)))))....))))))))),))))).,}.}}}}}}}...,,|{{(({.,,,.........})))).....||}}|}))....|||||((((......)))}...{(((((.(((((,,....,,.))))),)))))|(((((......}}}}}}}}))}}}}}|||||.{((({{{,({(({(({{{...(((,...}))).)))..))},,)))..}},))))).)}))})}}))))))))))..)))))).))..))))))|||,,,},,,,,{((((.(((.,{........,,))).))))|((((((...(((((...))))).{((((((.(((((((((....((..(((...(((((....))))).)))..)){((((.(((((((......)))))))..))))}((((..((((,..({({.((((((((((...((.(((((.(((.(((.(((.(((((((......)).))))).)))..)))..))).))))).)).))))..(((((((((,{{..((((((...{(((..,{{,(,{({.{..,((,..}}....)))))})),)))}..))))))..})}..)))))))))((((((.((...(((((((((((...{(((((((((((.....,.{{{{{|||...((((,{{......,},..,,,......,,.|||||....,}))),,..,..)))}.))))))))}...))))))))))))).))))))......(((((((.........))))))).........)))))).},,)),.))))}))).)))))).))).))))))|(({.(((((....))))).}))})))))))|||.......)))}}}}}....|||||}}}}|,,|||||,{{..||,.{{{.{||{{|{{,.|{{..(((((.{{......,}.)))))}))))),))))}.))),}),.}))}...}}|||||.,}}},||||,,,,|||||,.,}||,||||||....{((((((({...))))))))|(((((((((.{{{{{{{((({{,|||....,,{{}|||||||,|{,,...(((((((((........))))))))){|{{.,((({|.((((.((((((((....))))))))))))..{(((((((........))}}))))|(((((((.((({...}))))))))))}}||||{({,|,{{{..|.,({....))..,..})).,.)))},}}.{((((|....}))))},},)))))..}})),,,,,.||{|||||||},,.,,,.,,...,..,}}))))))))}}|{{{,.((((((..(((.(((((((..(((.......))).))))))).))))))))),{({{{({{{(({.,{{...,,{{,...,.,...}}}}}},,,,((((((...)))))).,.{(({,..}}))))}}}}}}}},....}}}}|,,|}}}}|||||},,,.|||,,,|{|{(||||||||{{,,,.|||{((({((((....,,.,,,.,))))))))))}}}|,|}}}},||{{||{||},,||({,.,.,,..,,...|||{{{{{{{{|,,,,.,,,,))))))))),,..)))).)))))}})|},.}))}}}})),.|,,,||,||||||||,||})))|||{{{{,|||||}|{{{{.{||({{{{{(....}))}..})},)})}})))))}..}}|||||,|.,||}{{|}}||||{.||{{|}}}}}..}}}}))))))))))..),)}))))))))),,,....}}},}.}|}}}|}.}|||,,,.}})))))}},,})),}}))))))}},,,,)}|}))))}),,|,.})))}))))})))},))))..),,)))))))))))))))))))}.,,|.,..(((((({...,((((((.....)))).))))))))).,.))),,,..)),)))))))).)))))}|,..((((..((((.(.((((((((.(((((...((((((({(,{...((((...(((((......(((,..{(((((((((((((({.((((((((((.((((((.(((.((((((((((.........}}}(((((......)))))....,.(((((((((......}}),......}))))),,.}},)))))))..)))))))))((((......)))),((((({{((..((.(((...((((.....))))...)))))..))))))))|,{((((((((...((((((((((((...(((((((((((..,{{......,|||(((((.....))))).,||||{.....|||}},...,,{{{,.......((((((..............))))))..{(((((...(((((((((((((((((((((,(.((.(((......)))))}})))))}})))))),((((((..(((((({.{({({,((((.(((((...,(({,(((...,....,.,,)}))))....))))).))))..(((((((((.........((((..({(((((((((((..((..((,,{.{{{{{{{{{,...((.(((((.(((((((({,(.((((((...((((..((((((..(((.{((((({....,,....)))))}|((((...))))}{(({{{....}}}))...)))..))))))...))))...)))))).)))))))))).)),,)).)),,((({,,,,{||||,..,{((((.((((((((..(((((((((..(((..((((.......))))..))}.))))))))).)))}},,{{,.....}}}}....(((((.,(((((..((((((((,.......))))).)))..))))},,))))}....,,))).})))))}}}},.}}},..{{(((((....))))))}..((((((.((((((.((((((.((((.(..(((((.(((....)))..)))))..)..)))))))))).)))))).))))))...||..{||||||||.,,,.},,),))}....))..)))))))))))..,}..))))))))))))).((((((((...((((.((((((((.(((((..(((((((.(((((..(((((.((((((...(((((({.,{{.,,,,|,.((((((((((......)).)))))))}..(((((({{((((.......}}}}}.,,},,}.{(((((((((....,{({...,}}}.....))))))))))..}}}}))),}},.,,.{{........}}((((((.((...((((..(((((((((((.((((((((((((((((((((.(((((.....(((((((.((.(((((((({..((((((((........)).))))))..........,,,......})).|(((((.((((((....)))))).))))))))))))))....))...))))))).....))))).)))))))...(((((.....)))))........)))))))))))))..)))))).)))))...))))......)))))))),.)))))))))))))))))...))))).))))))).(((.(((((..,...,..))))).)))..{((((((..((((,{(......))}))}..)))))))....(((((.((((.....,,)}}}))))).,..(((((((((.....)))))))))..},.....{((((((.(((((.......))))).))))))),|.,,{{((..((.{{{{{{,,....}}}}}}..}}..))}}|((((((((({{{({((((((.......{{.{(((....,{|||||}....}}}),))}}...,,)}}},.,)))))){{{{{.......})})},......,,,,,.(((((((.....)))))))..)))))))))}|{{..{{.{.(((((.((((((((.(((,(((.....))).,,.))).))))))))))))).,.}}.}}}{(((((((((((...((((((......((((.((((((((({.(((((..{((((......|}}}}.|..}||||,}|,,.{({.((((((.((((,....(((((((........(((((.(((.(((((((((...{{{{({((((((({({{{.....,|||,,|||||||,,||},,((({(..........,))))|....,,{,,..{,,..,|,,{{((((...}))))|.,||||}}|||||.|}}|}}........({((({{,{((((.{{{{{{.,,.((((.(((...((.((((......))))..))..))).)))).)),,,.}),))))))),)}))..|{|{||{{{.|{{|||,,..,,|||{......))))}}..}))})},..))))}))},..(((((((((.....(((...(((((((...)))))))...)))..)))))))))...{{{{{{{...,....)))))))}}...))))))))).))).)).))))))))))(((((....))))){(((.(((((((.........)))))))..)))))))).)))))).,,,...(((((((((,,{{.((((((((....))))))))..})....),})))))))),,||,|..,||(((((........)))}.}}|{{..........|}},{{{.......,,,...{{{{.((({...((({(((((({....}))))))..(((.{{{{{((({....)))).}})}..)))...))))...)))))))}....))))))))).))))......))))))))))).))))))}........{{(,((((((((.((((((((..((((((((((...)))))).(((((((,.........((((((((((({{{,.((((((((((...,............,.)))))))))).,}|{{,..,,||||{,,..,{{(({,,,{{{{.{||,|}.,|.|||||}},{|||,,,,...,}})),.,||||,,,}}},,,,,},....(((((((((..,...(((........))).,..))))))))).,)))))))))))(((((((({(((((((..,.,..((((..((({...,))).))))..,,.{((((,{((((((......((((.((.{{....,{|{{..,.{{{{(,,((((((({...,(.((((((((((.((..{((,,{,..((((.......{(((((((({.{(((((((.(.....(((((.,,..((((((((((.((.,{((((((((....(((((......))))}.,,..{{{...((((((((((((..........)))))))..)))))......}}}......))))))))|((,,(((((((((......))))))))).,)).}.)).)))))))))),})))))....{{((......)})}.}.))))))))})))}})))}........})}}..........}}),,.)))))))))))).))))))..||||||{{{(((((((((..((((...(((.......)))....)))).))))))))}.,{{{{{,}}}|||}||,......}})}})))}}...}}),)),,.,,.((({{,,..((((,{.(((...})).}}..))))....}}.))).,,....((({...}))))}.))))..((((((((.......))))))))......)))))))))))}.....)))))))..})).)))))).((((((((..........(({.((((((((........)))))))))))..))))))))...((((((((.(.((......))).))),})))),{,........}}}((((((.{((((.((((((((.(({,((.(((({...,.,,,..((({(..{,,,{{{|....))..,)}))))}))))).))))).)))))))).)))))))))))))))))).............))))...))))).....))).)))).)))}..))})))))))))))))))))...)).)))))),}},,,,,.....,{{{,.}||{||,}},}}}}.|),))},.||||.......|{(((,{{(({.......}}}},,,,,,.,||........}},.,...,}}),)}|.((((((((((((.{,.((((((...(((((((.......))))))).......((((...(((((.(((....))))))))....))))....(((((((({{((.....,,,{((,,,,||}..,,|,.....}||}.,,...{,{,{...{,,((({{{..{{(,,,.},.}}}}}},},|,}},},,},.,.|||||{||||||.,||,,,,})).})),,..))}))))),...((((((.....)))))).)))))))))))))).,}.)))))))))))).,((((({....))))))....)))))))))...))))))))).)))))))))))...))))))).)))))((((.....((((((.(({.....}))))))))....))))(((((((((((((.((((((.....,({{((,(...((((((((.....(((((((.(.((.(((,.{((((((((((((((.(((({((.((.((((((((((....))))..)))))).)).))}((((....)))).....((((..........((((((((((,{..(((((((....((((...))))....)))))))..,,..)))),})))))))))((((((((((.(((..........)))..)))).).)))))....,{..(((((((((........)))).)))))..}|(((((,.(((({....}))))...).))))),....))))..)).)))).))).))))},).}))).)).).)))))))...)))))))).,,}}}}}{{((...,|.,{||,.((((((....))))))))))...,,,},,.)))))).)))))))....)))))).......))))))))),.....(({....))))))))))))).}},....,}}))))),,)))))))))......)))))...)))).....,)).)))))))))))).)))))....))).).)))).)))).},.,.(((((......)))))((((.{{{({|,.{{(.((((....}))).)},..,.....(((.((((.....)))))))(((((((({{(.......}}}....)))))))).,})))}.)))}..,{((({....))))))},))))))))).)....))))))))).)))))).))},.))).))}}(((((((........))))))}))))))).)))))).)))))}}))}|{({,{{,.,,,.,|||},,,{||,.|||{.,},,)))|,||||{{{,,,,,,..{(((.((({......}))))))}..(((((((((.,{{,((((((({,((.((((.(.((((((((.{{{((((((((({,,......(((((..((((((....,})))}))..)))))((((.(((((({.((((((((.(((....((((((((.((.,{{{{((({{,,..,{{{{{{{...||||||......,,{....}}}|..{{{{{{(({{(((((((.{{...,.(((({......})))).||{{{{|.||.,,....{(((|...|)))|..,.,,{((((((((((,.(((({{{{{{{{{{..{{{{.,{...(((((((..,,....((({...}})).,,,..)))))))...||(,.((((((((..(((((((.((({,{{((((((((.(((((((((((..{....}.))))))).((.((((..((.((((((((((.((((({((((,,...,(((((((.....)))))))},.))))}...(((((.,({{{((((((,((.{{(((....))))}.......,,.,..((((((....))))))..,{||..((((((((((.,,{{..{((((.((((((((.((..((.(((((....))))).)).))...)))))))).)))))..,,,,........((((((((......))))))))..)))))))))},,,.(((((........)))))....,,,...,,,...((({...}))},)}))))))))).,)))))))))))))}})))))))).)))).)).((((((((((((((({,........,,..(((((((.((.((((((...,,,,.....,.,,,,.((((((((((((((((..((.((((((...(((....(((((((,{{((((((({{{||..|,,,,,.,{,((((.((((...((((((({{,,,....,}}.,,.,,.})))))))))))))).((((((((((.{({..(((((((.,{{.......|}}......((((.{(....)).))))........)))))))})).))))).)))))........((((....))))...,{(((((((...)))))))||(((((((.(((({.....{{{({.....})))))),)).)))).))))))}}}})))))))))))}}),{,..,..(((((((.......)))))))..,..||{((((((((.((((((........))}}}),}).))))))))}.,,,,,..{||||.{{{{((((((((((((......))))....(((((((({..,((((((((((...((((.,((((.((((...((........))...)))).)))))))))))))))))))))))))))..))))))))...,,,}}}}})})).(((((((.(((,...({,.....))).,,,,.}}}.))))))).))))......))).)))))).))..)))))))}}))))))))....))))....)))))).)).))))))).......{((((.,,......,....))))}.{(((((({....(((.,,,({,,((((((,{.{{{{{.(((((((((.............))))))))).....{,.,.{{|}}},,},,,},,}))}}}}}....||,)))))}.,}})))},)},}..))),,.}}})}}}}}((((((..(((((.......)))))...))))))....,)))))))}})))))))..((((((.((((.(({.......{{{.((((....))))}}|(((((((..,,...(((.((((..((((((....)))).))..))))))).,,)))))))}....))))))).))))))..)))).}})))))))})))).))..(((,,......}))}},..{({,,((((....)))))))}(((((....))))))))))..)))))))),.}{|{(((({{(({..(((({.,.|||,..})).}.))))).(((((((....)))).))))}|||||{,||}}}..{(((((((((......)))))))))}(((((.....)))))}))),,}}})))))}}}.))}...})))}}}))))}.((((((...(((((.(((.(((((.,....((({{.(((({....}}})),,.,)))}}.((((..((((...,,.,..{(((({({((((({(((((((((......(((((((..(((....))).))))))){,...,}(((((((((.((((((..((((({((..{((({,..{{,,,...}},,,.})))}..}}}|((((((((.,..{(({,...,)))).,.))))))))|{{{{...||,,}|||,,{||,,{.,{{,.((({{.(((....)))..})))}.,,,,.,,}}}}))},}}}},,,,,(((((((({((((((.......))))).}|(((((((....((((({,(((((((((((.((((((.((((.(((....)))))))....,....,..{(((.((.((((((((((....(((((.....(((((.,.......(((((....((((((.{{{({{,{{,.,..........,(((((({,{....,)))))))..))))..))))))....))))),.)))))......)))))....)))))...((((.((((((.....))))))))))..(((......))).))))).)).)))|((({{((({....}))))))),..)))..))).)))}}))))))))))))).............(((((...)))))..)))))))..(((((((.....))))))).)))))))).(((((...)))))...,))))))))))))))))))).))))).))))..}.))))))))))))..}},......))))..)))).((((....,,,.)),,...}))))))).))))).))))))||}))}}..}))}.)),)}}})))...}}}))...)))))..,}}},,,,,....{((({{((((,...})))))}}))}}}{{(((({(((|,{{({{,.,,,,,.,|||}}}}}},....}}}{(((((((({,((((((.(((.(((((,((((((((((((.(((((((.,....(((((((((((((.,.......)))))))......)))))}....((((((((((((((((((((.((((........)))).)))|,((.((,(({..,....|||,|}.}}},..((((....))))((((({.,(((((({{((.....))))))))))))))){{({|.{{|,|.{{....,||||,},,|||||{{..,{{,||||||,..{{{{,{||||,.{{{{{{{{{((((,((((........)))),}},.((((({,.....,(((((.....))))))},})))}.,{(,.,,,,|||.,{{|||||||||}}||,,}||||||||}..,,....,.,|{|||((({{,.,}}}}}.......,,,|}{|,(((((({((({{{{.,..,}}},,....))).))))))),...}|{||||||.,,,,,||}||{|||,{{(((((({|{{{||,},,.....((((((((...{{{..{((..(((((((((.,.{{{,{{,.{{(((((((((.((((({{{,..((((((((((.........)).)))))))}.....{(((...}))|{{{{{{{(((((......)))),.,||}|..,}}}}}.,,.,,}))))))))))))))})}}))))}))}},|,{(((((,(.,,((((((((((....,{{,.(((((((((..........,,..(((((.((((({.....{((((..(((((.((((.....))).).)))))..)))))))))).))))).,}..........))))))))).,..||.{((({((((((,...,,..||||}},.,,,}}))}.}}...))}))))}}})))))))))).,,),),)))))),}..,)).,))),.)))})))))))........,.,.,,,|,.....}}||{||,.....))}}}..,,,,,,,,,,,,{{,((((((((...........)))))))))}))}}}}}}}}..}},,,,,}},((((........)))).....,,}}}}.,)})))))).((((((((((,{((((((((((...))))))))))}|,,.........}}},|{(({({{....))))...)))),))))))))))............|||,},|||{{{|.|{,,.,||,}}}}})),..,))))))))))))).)))))..)))))))..,{{{,.,..}|||..(((..(((((({.{,...,,{||,,.{((((,..{{{{{,||||,.,||..}}}}},........((((((......((((.((((((((.....))))))))..))))..)))))).}}}}}}}}}.....}}}}}....,))))))..))).........))))))))))))...(((.(..((((((((((...))))}})))))..).)))...((((((....(((........)))..)))))).......,)))))..)))..)))))))))))))))}..})))))).,((((((((((((((...)))))))))})))))..)).)))))))))))))))))))(((((((((......)))).)))))(((((.(((((.....))))).))))).{{{,...}))){((((...})))),..}))))))}})),|{{{........))),)))))),.,)))).))))))}}..},}.)))).)))))))))))}....(((((..((((........))).)..)))))..(((.(((((..{{((.........})))...))))))))(((....)))(((((((((((((..((((((((({{{.,{{.,||}||((((((((..(((((((.((((...(((((({{(((((((((....)))))),}},,}},...)))))).)))).)))))))..)))).)))}.,{{{{{{,,,.,,.,))}}})),})))))).)))))))))))))((((.{....}))))|.(((((((((.((((((.{{....((((......(((((((((...(((((..(((((((....}))))))....)))))........{{{{,{,,...,,.},,,}}....(((((((..((((((((((((.{.((.((((.(((((.((((((((.{(((,(,.,{.....,,)))))})))))....)),.)),))).)))).))}.))))))))..,))))..)))))))..........||{.....,}}....))))))))))))).,}}.)))))).)))))))))...)))))))))..{{||,.,,))))..)))))))))))}}}))).))))))}.{|{{||||||||||..,,({{{{||||{,....,{{{{,,.{((((......})|||.{.,||}}}}))))||||..,})))))))})))},.))))))))))).)))},....))))))).))))))).((.(((({.{,(((((....))))),|...........)))}))).|,......,,((((((((((.,(((((((,.((((..((((((.{,...,})))))).)))|((.(((((...,.(((((.......((((.((((.{,...{(((((...}}}}}|}}.,..}),.)))).))))))))).}..))))}.|}(((((.((.(((((..((((((.(((((((........(((((...((((({((((....))))})))))..)))))..,,,((((((((..(((........))).))))))))}......))))))).))))))..).)))).)))))))...,},)))..)))))))))),,.....,,,,...,|||||.,,,..,,,.....})}.)).)))}}))},}}...)))))),..)))).))).))))))).{(((....))))....,(((..((((((((((...((((,.{((((.(((.{(((((((((.(((,.{((((((.(((,((.((((...((((((..,........)))))).)))).)}}))})))))}.,}}...})).)))))))))}.))).)))))))))..))))))))))..))},(({..((({....}}))..}}}....((((((((((({((((...))))}(((......))))))}..,)))))))..........((((((.{(((.......}},........{((((({{(,,{....((((...)))))))),})))}{{{{{..((,..,)}.})))),{{{{{....{{((,,{((((,,,,....}}}}}.....})}}....)))))}))))},),),,})))))))}....))))))))..,.)))),..

Transcripts

ID Sequence Length GC content
GGUAGUAAGAAUCAGCAGCGCGGGCAAGGAGUACGGACGGGAGUCAGAG… 19557 nt 0.4249
Summary

This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using single-cell/nucleus RNA sequencing of carotid atherosclerosis and Alzheimer's disease datasets identified the ADGRV1 as a marker for manual annotation of astrocyte clusters [Xue et al. DOI:10.3233/JAD-230559]. A study in zebrafish demonstrated that the ADGRV1 (Gpr98) was part of an 11-gene transcript set used in a perfectly-defined linear regression model to predict postmortem interval, with this specific set yielding an R² of 1 and a slope of 0.99 between predicted and actual time [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027].