Basic Information

Symbol
CSNK2A2
RNA class
mRNA
Alias
Casein Kinase 2 Alpha 2 CK2alpha' CSNK2A1 Casein Kinase 2, Alpha Prime Polypeptide Casein Kinase II Subunit Alpha' Casein Kinase 2 Alpha' CK II Alpha' EC 2.7.11.1 CK2A2 EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Wound age identification Postmortem interval inference

MANE select

Transcript ID
NM_001896.4
Sequence length
1887.0 nt
GC content
0.5527

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-663.10 kcal/mol
Thermodynamic ensemble
Free energy: -698.35 kcal/mol
Frequency: 0.0000
Diversity: 506.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((((((((((.(.((...(((.((((((....(((((((((((.((((....)))))))))))..))))......)))))).))).)).))))))))).(((.((((.((((.((.(((((((((...((.(((.....))).))....((((.((((.((((.((..(((((.....))))))).)))).))))))))..))))))..))))).))))(((.((..(((((((((((.................)))))..))))))..)).)))..........(((((...)))))..)))).)))..(((((((((((...((((((((.......((((((((((((.(((((((.(((((((..((((.(((((......)))))))))...)))).)))............(((((.(((((......))).)).)))))......((((((((((((((((...))))))))..))))))))......))).))))..........((((((((((((((((((.(((((.....(((((.(.....).))))).....((((((.((.((.((.((...((((......((((.(((((............)))))))))((((...(((((((((..((((((.(((((((.((.....))...)))))))......)))))))))))))))....))))......................(((.(((((((((((((.....(((.....((((((((((((((((....(((...(((.(((.......))).))).)))...)))))))......))))))))))))...))))..(((..((((....(((......)))....))))..)))))))))))).))).)))).)).)))))))))))).....))))).)))..))))))).)))))))).)))))).(((((..(((((.(........).)))))....)))))..((.((((((((((((((.((..((((((......((....))...((((.((((......))))...(((((((..((((((((.(((((((((.((((((((((((.((((((.....))))))((((((((((((....(((...........))).....)))))..)))))))((......))..........((((((((........))).)))))....)))).)))))((((((...((((((...(((((((((...........((((((.((((.((......(((((.(((((.....))).((((.....)))).((((.(((....))))))).))))))).((((.((((....)))).)))).((((((((((....(((((......)).)))..))))))))))))..))))))))))((((((....(((......))).......)))))).......((((......)))).)))).)))))((((((.(((((..........(((((((...(((((((.((......)).).))))))...(((...))).))))))).........)))))....)))))).((((((......))))))))))))..))))))..(((((...((((.......))))....).))))))))))).)))))..))))))))..)))).))).((((........))))))))((((....(((......)))....))))))))))..)).).)).)))))))))))))))))))..))))))))...)))))..))))))................(((((((.(...((((....))))...).))))))))))).
Thermodynamic Ensemble Prediction
.........{{,,{{{{{(((,{{((,(((((.((((((....(((((((((((.((((....)))))))))))..))))......)))))).))).)),|}||||||,..((.((((.(((((.({(.,{,.|||.,}||,||,..||(((((((.{,,((({(((((.((((.((..(((((.....)))))}),)))).}}}|||}}..)))))))))))}}})|))|||,|{..(((((((((((.................)))))..)))))).,)).||.....,,}}..(((((...)))))....)},)))},{{{{{{(((((...((((((((....,,.(((((((({(((,((((({,.((({{{{..|||{,|||||....,,)))))))}}...}|||,|}|,,...,{{,{{.{((((,(((({..,.,.}}}.)}.)||||.,{||,((((((((((((((({...})))))))..))))))))......}}}.}}))..........((((((((((((((((((.{{(((.{{,.,{,,{.,....,),))|||,....((((({,({,((,((,((...,{{,.......,{{{.({((,{{{.,{{{...,}}}}}},|((((...(((((((((..((((((.(((((((.{,.....,,...)))))))......)))))))))))))))....)))),......}}}},}}},}.}...||{.(((((((((({{{{,{.,((,.....((((((((((((((((....(((...(((.(((.......))).))),))}...))))))}......))))))))),,,}},}))),,|{{..((((....(((......)))....))))..,))))))))))).))}.)))).)),)})))))))))).}}},))))).)))..)))))))}}))))))).)))))).||||{,|}}||)),}}.|||},}.,.)}}},.,},)})}}{{.((((((((((((((.((..((((((......{{....|||,.((({.{{{{..,,,.}}}},,.(((((((..((((((((,(.((((((((.((,.,{((((((((,{{(,,,,,}|||,.((((((({({{(,,({(((...........)))....,)))),..))))))),{{{{,,.,,,{{,{{{,,.((((((((......,.})}.|}|}}.,,,,,||,|,,.,|||{((,..{{((({,,,(({{{|||||.......||{({((({.{{{{.||..,,},|{{{(.{{(({...,.))).((((.....)))).{|||,{{{,,,,))))))).,}}}})),||||.{(((....}))}.}))}{((((((((((..,,(((((......)).))).,))))))))))}},,))))))))))((((((....(({......}}).,}....)))))).......((((......))))..,}},,}})){{{|||,|||{(..........(((((((..{(((((((..,...,..)),),)),,}}...(({...))).))))))).........}}}}}....)}}}}}.((((((......))))))})))))..))))}},}}})).,.})))))},..}.,,)).)))))))).)),,,||.,.,,,..))))))))..)))).))).((((...,}}).,}})))),((((..,.(((......))),...))))))))))..)).).)).)))))))))))}})))))).}))))))))...)))))..)))))),}}.........,,.,{({{{{{,|,..{{{|....}}}}...},}}}}}}})}},.

Transcripts

ID Sequence Length GC content
CUCUCCUCCUUCUUCUCCGCUGCCGCCGCCGCUGCCCCUUUCCCGGCCG… 1887 nt 0.5527
Summary

This gene encodes the alpha', or alpha 2, catalytic subunit of the protein kinase enzyme, casein kinase 2 (CK2). Casein kinase 2 is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythms. This heterotetrameric kinase includes two catalytic subunits, either alpha or alpha', and two regulatory beta subunits. The closely related gene paralog encoding the alpha, or alpha 1 subunit (CSNK2A1, Gene ID: 1457) is found on chromosome 20. An intronic variant in this gene (alpha 2) may be associated with leukocyte telomere length in a South Asian population. A related transcribed pseudogene is found on chromosome 11. [provided by RefSeq, Aug 2017]

Forensic Context

A study in porcine (Yorkshire crossbred swine) skin exposed to bromine demonstrated that the CSNK2A2 gene, a signaling component, exhibited significantly increased expression specifically in the 8 min–7 d post-exposure experimental group [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. This transcriptional change was identified as part of the EGF, IGF-1, and PDGF signaling pathways through microarray analysis and Ingenuity Pathways Analysis, indicating its involvement in the molecular response to chemical injury. A study in mice demonstrated that the CSNK2A2 transcript increased in abundance within 0.5 hours postmortem, classifying it as an apoptosis and cancer-related gene [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a separate investigation using rat liver tissue following burn injury, the CSNK2A2 was identified as a signaling gene with significantly altered expression on day 7 post-injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].