Basic Information

Symbol
CST1
RNA class
mRNA
Alias
Cystatin SN Salivary Cystatin-SA-1 Cystain-SA-I Cystatin-SN Cysteine Proteinase Inhibitor, Type 2 Family Cystatin SA-I Cystatin 1 Cystatin-1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Chronological age estimation

MANE select

Transcript ID
NM_001898.3
Sequence length
749.0 nt
GC content
0.5821

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-256.10 kcal/mol
Thermodynamic ensemble
Free energy: -269.77 kcal/mol
Frequency: 0.0000
Diversity: 247.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((((......((((((....((((....(((.....)))))))....)))))).....))))).((((....))))(((...(((((.(((((((((.......))))))..)))..)))))....)))..)))).)))).........((((((...............((((....)))).((((((...)))))).....(((((.....))))).........))))))...((((.(((((......(((.(.(((.(((.......)))..))).).))).((((((((((((...))))))))))))(((((((((((..........(((((((.((.((((..((((..((((.(((((((((((..((...(((.(.(((((.........))))).)))).(((((.......))))).(((((((((.....((.....(((((......)))))..)).....)))))))))(((((((((((((((....((((((((...........(((........)))..........))).)))))(((((((.......))).)))).....))).))))).))......)))))))..)))))).))))).))))...))))......(((((.....)))))...............(((......))).)))).)).)))))))......))))))).))))........)))))))))...
Thermodynamic Ensemble Prediction
(((,{.(((({.{(((({{.,.,((((((,,.,({{(,,,,(((.....|||}}||....}}}})}....{{{|{{((((...(((({......}}}}}.}))}|||||{....,..)})))),.))),,)))))..,.,}}|||}||,,,{,...,||}..((((((.,,{........,,.{{{,....||||.((((((...)))))).,,|,,{(((.....)))))}........))))))...|||{.{{,,,..||.|||}.|,|||}|||....,}}))),}))}.|,|,..{,((((((((((...,{{{{({,,..,,.}}}|||((,..,{{|}...((({(((,((.{{{{..{{||,,||||,{((({|{((((..{(...((,{(.(((((.........))))).)))).,{(((.......)))}|.(((((((((.....{,..,.,(((((......))))).,}).....))))))))){||{{(({((({{{{..{{{{{{({{{.....,.,...,,,....,}.,)))...,,.....))).,))))||{{{{{.,...}.))).)))}...,,|||,|||}|.||...,{,|,||,}|,.|||||}.|}}}|.|}}}...}}}}....|.(((((,...,)))))........,,,,,,.|{|,,,...})).)})),)),)))}}},))))))))))}},,|||,........,),}))......

Transcripts

ID Sequence Length GC content
GCUCCCUGCCUCGGGCUCUCACCCUCCUCUCCUGCAGCUCCAGCUUUGU… 749 nt 0.5821
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a cysteine proteinase inhibitor found in saliva, tears, urine, and seminal fluid. [provided by RefSeq, Jul 2008]

Forensic Context

A review of forensic proteomics literature notes that the CST1 is a protein marker found in saliva for body fluid identification and shows age-dependent expression changes in oral fluid for donor profiling [Alex et al. DOI:10.1016/j.scijus.2025.101320].