| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCCUGCCUCGGGCUCUCACCCUCCUCUCCUGCAGCUCCAGCUUUGU… | 749 nt | 0.5821 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a cysteine proteinase inhibitor found in saliva, tears, urine, and seminal fluid. [provided by RefSeq, Jul 2008]
A review of forensic proteomics literature notes that the CST1 is a protein marker found in saliva for body fluid identification and shows age-dependent expression changes in oral fluid for donor profiling [Alex et al. DOI:10.1016/j.scijus.2025.101320].