Basic Information

Symbol
CST2
RNA class
mRNA
Alias
Cystatin SA Cystatin-SA Cystatin 2 Salivary Cysteine (Thiol) Protease Inhibitor Cysteine-Proteinase Inhibitor Cystatin S5 Cystatin-S5 Cystatin-2
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001322.3
Sequence length
746.0 nt
GC content
0.5818

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-278.40 kcal/mol
Thermodynamic ensemble
Free energy: -290.67 kcal/mol
Frequency: 0.0000
Diversity: 144.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((....(((...))).......((((((....((((....(((.....)))))))....))))))(((((((((.(((..(((((...((((.(.(((((.((((...((((((((........))))))).)...)))).))))).)))))......((((...(((((...)))))...)))).....((((.((((((...)))))))))).((((((.((((.(.((........))).)))).))))))...)))))....(((((((((((((.((.((((((((((((...((.(((.((((((....((((((.......))))))((......))...(((.((((((.........))))))))).((((.(((((((.((((..(.(((.(((..(((((.((....))..))))).))).)))..)..))))..)))))))))))....(((((((((.(((((((((........)))).)))))...)))))))))((((...)))).......))).))).)))..))...))))))).....))).)).))(((((((((...))))).)))).......)))))))))))))((((((.(((((((((.....(((((((((((((....)))))))).......)))))..)))))..))))))))))...)))..))).)))))).................((((.........)))).)))...
Thermodynamic Ensemble Prediction
{{,....(((...))}.......((((((....((((....(((.....)))))))....)))))){{{{{||{{.|({..(((((...((((,(.(((((,{{((,..,((((((({......,))))))).),,.}))),))})).}))))......((((...(((((...)))))...)))).....{(((.((((((...)))))))))},{(((((.((((.(.((........))).)))).)))))},..,}}}}...{(((((((((((((.,,.((((((((((((...((.(((.(((({(,....,{{{{.......}||||{((......}}...(((.((((((.........))))))))}.((((.(((((((.((((..{.(((.(((..(((((.((....))..))))).))).)))..}..))))..)))))))))))....(((((((((.(((((((((........)))).)))))...}))))))))((({...})))}}}}}}.,,}.))).})),.))...)))))}}...,}))).)){|,(((((((((...))))).)))).}}....)))))))))))))|(((((.(((((((((..{{{(((({((((((((....}))))))).,,,,,,,,,,,..)))))..})}))))))}...))}..))}.)}}))}..............,,.{{(|.......}}),,),},}...

Transcripts

ID Sequence Length GC content
GAUCCCCGCCUCAGGCUCUCAACCUCCUCUCCUGCAGCUCCAGCUCUGU… 746 nt 0.5818
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted thiol protease inhibitor found at high levels in saliva, tears and seminal plasma. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CST2 is a widely recognized protein for proteomics-based body fluid classification of saliva, though it did not rank among those with the highest discriminatory power in this analysis as it may be present in trace concentrations in other body fluids [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].