| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUCCCCGCCUCAGGCUCUCAACCUCCUCUCCUGCAGCUCCAGCUCUGU… | 746 nt | 0.5818 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted thiol protease inhibitor found at high levels in saliva, tears and seminal plasma. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CST2 is a widely recognized protein for proteomics-based body fluid classification of saliva, though it did not rank among those with the highest discriminatory power in this analysis as it may be present in trace concentrations in other body fluids [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].