Basic Information

Symbol
CST3
RNA class
mRNA
Alias
Cystatin C Neuroendocrine Basic Polypeptide Post-Gamma-Globulin Gamma-Trace Cystatin-C Cystatin C (Amyloid Angiopathy And Cerebral Hemorrhage) Epididymis Secretory Protein Li 2 BA218C14.4 (Cystatin C) Cystatin 3 Cystatin-3 HEL-S-2 ADLDWA ARMD11
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_000099.4
Sequence length
793.0 nt
GC content
0.6419

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-318.20 kcal/mol
Thermodynamic ensemble
Free energy: -330.62 kcal/mol
Frequency: 0.0000
Diversity: 219.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((((((((((((.((((((.(.(.((((((.(((((((.....(((((((((((..((((((((((...((((((..(((......))).((((((((((((((...((.(((..((((((.....((((....((((..(((((((.....)))))))))))))))..))))))))).)).))))...))))).)))))...))))))..)))))).))))..))))))).))))....)))))....((((.((((..(((((..................)))))....)))))).)).)))))))).).).))))))..)).)))....))))))))))..........((.(((((((..((((.........(((.(((((...........))))))))...)))).))))))).))(((...(((((.((((...((((...)))))))).)))))....)))(((.(((((((((......((((...)))).......))))))))).)))((((((((..((((.(((.(((..(((((.((........)).)))))....)))..))).))))....)))))))).((((((......(((.((((((.....)))))).).))...))))))((((..((..(((.(((..(((((.(.((((((((....)))))))).)))))))))..)))..))..))))(((......)))...((((.(.((((....)))).)))))..((((.........))))....)))
Thermodynamic Ensemble Prediction
..({{((((((.(((((.,{{,{|(((,...},}...||.||(((((...,.(((({((((((..((((((((((...((((((..(((.....,))).((((((((((((((...((.(((..,(((((,,...{|||||{{((,,,.((({{{{.,,.,))))))))),,))}}..,,)))}))).)).))))...))))).)))))...))))))..)))))).))))..))))))).)))).}..)))))...}}}}}..)))))|..|.......(((((.((((..(((......(,{(((((((,....,))))))))},.,...)))..)))).))))){{{{..,,,,,,,,{((.((((({{..((((.,......,(((.(((((...........)))))))}...}}}}.}}}}}}}.}||((...(((((.((((,..((({...}))))))).)))))....))}|{{.{((((((((|.....{(((...)))).....,.}}})))))).}}}((((((((..((((.(((.(((..(((((.((........)).)))))....))).})),.))))....)))))))).((((({,{....(({.((((((.....)))))).).))..}))))))((((.((.,{({(((((.,(,{(({({((((((((....}))))))).)}))))}....,,}}}})}})))}}}}))))...}}...((((.(.((((....)))),}))))..,{||.........))})}},,)}}

Transcripts

ID Sequence Length GC content
ACGGCCUCGCCUCGGUAUCGCAGCGGGUCCUCUCUAUCUAGCUCCAGCC… 793 nt 0.6419
ACGGCCUCGCCUCGGUAUCGCAGCGGGUCCUCUCUAUCUAGCUCCAGCC… 3296 nt 0.4603
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. In addition, this protein has been shown to have an antimicrobial function, inhibiting the replication of herpes simplex virus. Alternative splicing results in multiple transcript variants encoding a single protein. [provided by RefSeq, Nov 2014]

Forensic Context

A study in human blood plasma demonstrated that the CST3 (Cystatin-C) was significantly upregulated with age and was used as a protein biomarker for building chronological age-predictive models [Salignon et al. DOI:10.18632/aging.204787]. The proteomic model incorporating this and other proteins achieved a prediction accuracy of R² = 0.59 ± 0.02, and combining protein data with miRNA data further improved the model performance to R² = 0.70 ± 0.01.