Basic Information

Symbol
CST4
RNA class
mRNA
Alias
Cystatin S Salivary Acidic Protein 1 Cystatin-SA-III Cystatin-S Cystatin 4 Cystatin-4
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001899.3
Sequence length
749.0 nt
GC content
0.5834

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-271.90 kcal/mol
Thermodynamic ensemble
Free energy: -284.46 kcal/mol
Frequency: 0.0000
Diversity: 212.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.....))..((((((......((((((....((((....(((.....)))))))....)))))).....))))))((..((((......((.(((((((((((((...(((...((((((((.......))))))))...)))......((......))((((.(((((...)))))..))))......((((.((((((...))))))))))....)))))))).)))))))....((((((((.....(((((((((((.....(((.((....)).))).(((..((.(((((((((((((..((((..((((((((.......))))))))....))))...(((.((((((.........))))))))).((((.(((((((.(((((((.(.(((((.........))))).))))..((((.......))))))))..)))))))))))..((.((((((......))))).).)).....))))))))))))).)).)))..(((.....)))...................)))))))))))(((....)))..)))))))).......(((((((((........(((((((((((((((((.((((.((.(((((..(((((.((((((((.....))).)))))..))))).......))))))))).)).))))........))))))).))))))..........))))))))).....))))..))......
Thermodynamic Ensemble Prediction
((,,{(((,,,((((((,.....((((((....((((....(((.....)))))))....)))))).....))))){((.((((({{{,,,({.(((((((((((((...(((...((((((((.......)))))))).,.)))......((,...,}),((((.(((((...)))))..))))....{,((((.((((((...))))))))))..,,)))))))).)))))},.,.,||||,||......|,||||,||||}.}}},{,.|{,|,.|),||}}||||||||||,..,,..{(((((((((.....((((({.{{{{{||,{((({,...||}},,.{{{.{(((((.........})))))))|.((((.(((((((.((((((,{(.(((((.........))))).))))..{(((.......)))}))))..)))))))))))..||,|(((((......))))).),))}}}}},||,{{((({|({{,|.||,..|{|.},..))),.}}...}}},}}}.,,,,}})},))))))|||.,..)))..}|||||||,||,},.{{{|(({|{........(((((((((((((,({{.,(({.{({(((((..({{(((({.,,,{{,,,,.,,)}||||{,,.,}))}},..,,})},)))))))},})))........))))))).))))))..,.,,,,,.))}}}}|}}......,})},)),.....

Transcripts

ID Sequence Length GC content
GCUCCCUGCCUCGGGCUCUCACCCUCCUCUCCUGCAGCUCCAGCUUUGU… 749 nt 0.5834
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.