| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUCCUGCCUCAGCCUUCUGCUGCUUUGCUCUCUGGGAGAUCCAGCUC… | 755 nt | 0.5576 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein found in saliva and tears. The encoded protein may play a protective role against proteinases present in the oral cavity. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that Cystatin-D exhibited a Gini impurity score of 0, was present in most pure saliva samples and in mixtures containing saliva, and was absent in mixtures without saliva, confirming its role as a discriminatory protein for saliva classification in a proteomic workflow using LC-MS/MS [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].