| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGUUCCAUGCUGCCCAAGAAGGCUCAGCACAGGCACAAACCAUUGCC… | 891 nt | 0.5645 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the CST7 was upregulated in the neocortex and corpus callosum-external capsule at 7 days post-traumatic brain injury, indicating its role in the subacute immune response [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. In human research, the CST7 was utilized as a marker for manual annotation of T cell clusters in a carotid atherosclerosis single-cell RNA-seq dataset, establishing its cell-type specificity [Xue et al. DOI:10.3233/JAD-230559].