Basic Information

Symbol
CST7
RNA class
mRNA
Alias
Cystatin F Leukocystatin Cystatin-Like Metastasis-Associated Protein Cystatin-F Cystatin-7 CMAP Cystatin F (Leukocystatin)
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003650.4
Sequence length
891.0 nt
GC content
0.5645

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-312.00 kcal/mol
Thermodynamic ensemble
Free energy: -328.54 kcal/mol
Frequency: 0.0000
Diversity: 189.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((..(((((((.(((((..((((........)))).((((((((((((((((.(((....)))...))))))))).))).....))))......(((((((((((.(((.....))).)))...))).)))))............((((.((((.((((((((((((.(.(((.(((((..(((...........)))..)))..)).))).).))))))).)))).).)))).))))....))))))))))))((((((((((((((((((...((((((......)))))).....)))))..)))))).........((((..(((((((.......................((((((((((..((.....((((((((((..((((((((((...)))))).))))...((((.....))))((((((((((..(((.((((.....(((((....((((.....)))).))))).......)))).)))(((........((((......)))).......))).((....))(((.....)))((((..............))))))))).)))))..)))).)))))).....))..))))))))))..)))))))...))))..(((((.((.(((..(((((((((((((......((.......)).......)))...)))).)))....))).))).)).))))).............((....((((((((...(((..((((.((((...(((....))))))).))))...)))...))))))))..)).)))))))......)))))))))).))))..........((((.....))))....................
Thermodynamic Ensemble Prediction
..((((((((((((((...,,.{({.,.{{...((((........)))).((((((((((((((((.(((....)))...))))))))).))).....)))).(((.((((((((((......,,,,,{((((((.(((({.|((((........))))((((.((((,{(((((((((((.(.((({(,(((..(((...........)))..))).})},))).).)))))))},))).).)))).))))....)))))))))))){{{{,,{(((((((((((...(((((({....,)))))).....))))}.|}))}}}.........(((({.(((((((.......................((((((((((..((.....((((((((((..((((((((({...}))))),,)))...((((,...,)))){(((((((((.,(((.((((.....(((((.,..((((.....)))),))))).......)))).))}((({{...,,.((((......))))........||{({,,..},|{,|||,.}.,,,,,...}}}}.,},...,,}.)))))}}}))}..)))).)))))).....))..))))))))))..))))))).},|}}},,{((((,({.{({..{{,{({((({{((......|,.,,...,}},}}},..)}),..}}}}},.,....}}}.})}.)).))))),.......{{{{{({,{{{(,,{,((({{{,,,,{(,,{,||,|}},,,{,,..},)))))}))))}..)))...}))))),,.)))))))))).)))...)))))))))).))))..........{{,{...{{{{.|.....,,..}))}.......

Transcripts

ID Sequence Length GC content
ACUGUUCCAUGCUGCCCAAGAAGGCUCAGCACAGGCACAAACCAUUGCC… 891 nt 0.5645
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CST7 was upregulated in the neocortex and corpus callosum-external capsule at 7 days post-traumatic brain injury, indicating its role in the subacute immune response [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. In human research, the CST7 was utilized as a marker for manual annotation of T cell clusters in a carotid atherosclerosis single-cell RNA-seq dataset, establishing its cell-type specificity [Xue et al. DOI:10.3233/JAD-230559].