| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUUGGUUCCAGCAUCCUGUCCAGCAAAGAAGCAAUCAGCCAAAAUGA… | 744 nt | 0.3858 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008]
A study in humans and rats demonstrated that the CSTA is one of six hub genes used to build a diagnostic nomogram for myocardial infarction, with the model showing an AUC of 0.978 in a training set and 0.9 in a validation set [Wei et al. DOI:10.3389/fimmu.2022.1061800]. A study in humans demonstrated that the CSTA is upregulated in the salivary proteome of smokers, serving as a discriminating biomarker for donor profiling related to smoking status [Alex et al. DOI:10.1016/j.scijus.2025.101320].