Basic Information

Symbol
CSTA
RNA class
mRNA
Alias
Cystatin A STF1 STFA Cystatin A (Stefin A) Cystatin-A Cystatin AS Cystatin-AS Stefin A Stefin-A AREI PSS4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Drug abuse diagnoses

MANE select

Transcript ID
NM_005213.4
Sequence length
744.0 nt
GC content
0.3858

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-154.40 kcal/mol
Thermodynamic ensemble
Free energy: -171.33 kcal/mol
Frequency: 0.0000
Diversity: 193.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((((.........((......)).((((((......(((.((((((......((((.(((.......)))....))))..))))))..)))))))))..(((...)))(((((((((..............((.((..((......))..))))..............))))))))))))))))))(((.((((.......(((((...(((((((((.......))).))))))...))))).....((((....))))...((((((((((((((((....)).))))))))............(((((..(((.((..(((...((((((((.........(((..((((((((((.((((.((((.(((((....(((.....(((((((((((........(((((.((((......((((....))))......))))..))))).......)))).)))).)))(((((......)))))...)))...)))))))))........((((....))))........)))).)).))))))))..)))......((((.((.((((..........))))...)).))))........(((......((.(((.(((((((....((......)).....))))))))))))......)))))))))))...)))..))))))))))....)))))).................)))).))).....
Thermodynamic Ensemble Prediction
..,{{{(((((((((.,,{,,.,,((,.....||.((({{,.....||||.((((((......{{((,(((.......)))..},}))}..))))))..,))))))}}..({{...}}}(((((((((.......,,.....((.((,.({,.....}}.,)))).....},.......)))))))))))))))))).....,,,.......{((((...(((((({({.......))).))))))...))))}.....((((....))))...((((((((((((((((....)).))))))))...........,(((((..(((.((..(((.,.((((((((.........{((..(((((((({{.{{{,.{((({...,})))},,|,...|{{{{{{..........,,,{{{{({((({..,|||||....,{|||{...||,}}}..,,.}}},,,....,|}}|,,,},||}(((((......))))}........,,}|}||,,,,|}}},..((((....)))).......,}))),)).))))))))..)}}.......,(({{(,,((,....,,...})))),..||.|,||.,,....,({{......{{.(((.(((((((....({{,...,),..,,,)))))))})),}......)))))))))))...)))..))))))))),,,..))))))................,})}}.........

Transcripts

ID Sequence Length GC content
ACUUUGGUUCCAGCAUCCUGUCCAGCAAAGAAGCAAUCAGCCAAAAUGA… 744 nt 0.3858
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans and rats demonstrated that the CSTA is one of six hub genes used to build a diagnostic nomogram for myocardial infarction, with the model showing an AUC of 0.978 in a training set and 0.9 in a validation set [Wei et al. DOI:10.3389/fimmu.2022.1061800]. A study in humans demonstrated that the CSTA is upregulated in the salivary proteome of smokers, serving as a discriminating biomarker for donor profiling related to smoking status [Alex et al. DOI:10.1016/j.scijus.2025.101320].