| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGAGUCCCCUCGCCAGAUUCCCUCCGUCGCCGCCAAGAUGAUGUGCG… | 588 nt | 0.5034 |
The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]
A study in human skin identified the CSTB as a new marker for different differentiation stages of keratinocytes [Cheng et al. DOI:10.1093/burnst/tkae043]. A study in humans demonstrated that the CSTB showed strong signals in skin but exhibited high cross-reactivity in other mucosal tissues and fluids, leading to its exclusion from the final multiplex assay for body fluid identification [Xu et al. DOI:10.1371/journal.pone.0100123].