Basic Information

Symbol
CSTB
RNA class
mRNA
Alias
Cystatin B CST6 STFB PME Liver Thiol Proteinase Inhibitor Cystatin B (Stefin B) Cystatin-B CPI-B EPM1 Epididymis Secretory Sperm Binding Protein Epilepsy, Progressive Myoclonic 1 Stefin B Stefin-B EPM1A ULD
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000100.4
Sequence length
588.0 nt
GC content
0.5034

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-156.30 kcal/mol
Thermodynamic ensemble
Free energy: -168.41 kcal/mol
Frequency: 0.0000
Diversity: 142.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.((((....)))).)(((((.(((.((((........))))...((((.((((.....)))).))))..((((....)))).((((.......(((((.....))))))))).......((((.((((((((.((((((((((((((((.(((.((((.((.....)).).)))...))).))))))))......)))))....((((((((((.((.((((((((.((((((....))))))(((.((((..((....(((.((((...((..(.....((((((............................))))))..)..)).)))))))....))..))))))).(((......)))....((((.....)))).)))).))))..))...))))))))))((((..((......))..))))((((((((...))))...)))).(((((((((((....))))...(((....)))...)))))))..............))).)))))))))))).....))).)))))................(((((.((((((....)))))).))))).....
Thermodynamic Ensemble Prediction
(.((((....)))).}{((((.{{{.({((({{.....|.||{(((((((((((.....)))}.,}}...((((....)))).,.|}}.}}}}}}||{|.....)))))|)|,.,.,,..((((.((((((((.{{,(((((((((((((.,,,.((((.{{.....,,.).)))...}},.))))))))......))))){{{{(((((((((({((.((((((((.{(((((....)))))){{,{((((..((....(((.((({...{{...,||..{{{,{{.......,,{.........{,...},..),)),)})}.....}))))))....))..))))))}.(((......)))....((((.....)))).)))),})))..)).},}))))))))).})}}.,,......,},,||||{{{{((((...))))...)))),(((((((((((....))))...{((....)))...)))))))......,,,.....,)).)))))))))))).....})).))))}.......,...,{{{,(({{(,{{{{{{,,.,)))))).}))}}.....

Transcripts

ID Sequence Length GC content
GCCGAGUCCCCUCGCCAGAUUCCCUCCGUCGCCGCCAAGAUGAUGUGCG… 588 nt 0.5034
Summary

The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]

Forensic Context

A study in human skin identified the CSTB as a new marker for different differentiation stages of keratinocytes [Cheng et al. DOI:10.1093/burnst/tkae043]. A study in humans demonstrated that the CSTB showed strong signals in skin but exhibited high cross-reactivity in other mucosal tissues and fluids, leading to its exclusion from the final multiplex assay for body fluid identification [Xu et al. DOI:10.1371/journal.pone.0100123].