| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCGCUAGCCCGCAGCGCUCGGCUUCCUGGUAAUUCUUCACCUCUUUUC… | 6056 nt | 0.3813 | |
| ACCGCUAGCCCGCAGCGCUCGGCUUCCUGGUAAUUCUUCACCUCUUUUC… | 1870 nt | 0.4460 | |
| ACCGCUAGCCCGCAGCGCUCGGCUUCCUGGUAAUUCUUCACCUCUUUUC… | 6100 nt | 0.3810 |
This gene encodes a member of the peptidase C1 family and lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in cells of the immune system. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate heavy and light chains that form a disulfide-linked dimer. A portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. [provided by RefSeq, Nov 2015]
A study in humans analyzing heart tissue from patients with various structural heart diseases identified the CTSC as a differentially expressed gene, showing significant down-regulation in diseased samples compared to controls with a mean fold change of 0.5549 and an adjusted p-value of 7.2224 × 10^-18 [Fajarda et al. DOI:10.1186/s13040-020-00217-8]. In rats, RNA-seq analysis of cardiac fibroblasts across developmental ages found the CTSC was down-regulated in fetal cells compared to neonatal cells [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021]. A study in mice demonstrated that the CTSC transcript was upregulated 4.1-fold in the injured ipsilateral neocortex three days after a closed head weight-drop injury, indicating its role in proteolysis and inflammatory responses following mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676].