Basic Information

Symbol
CTSF
RNA class
mRNA
Alias
Cathepsin F CATSF CLN13 EC 3.4.22.41 EC 3.4.22
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_003793.4
Sequence length
2044.0 nt
GC content
0.6008

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-892.50 kcal/mol
Thermodynamic ensemble
Free energy: -924.40 kcal/mol
Frequency: 0.0000
Diversity: 413.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((.((....))..)))))).((((.((.(((((((..((((((....(((((((.....((((((.(((.((.(((......((((((((....))))....))))..(((((.((((((.((..((((((((.((....)).))))))))..)))))))).))))))))))))))))).))))))))))))))).....)))))))(((((((.(((((((.(((.(((((((((((((((((.((.((((((....)))).(((((((...)))))))((((((((.((((((..........)))))))))))))))))))))))))..(((((((.((((((((((((.((...)))))).))))......)))).)))))))..)).))))))))....((((((..((......))..((((.((((((((.....))))..)))))))).))))))....))).)))..)))).)))))))...(((((((.(((((((.((.(((((((.((((...((((((.(((((..(((((..((((((...((((((((((((((........((..((((((......((((........))))......))))))..)).((((.....))))((((.....))))(((((((.......)))))))....(((((((((..((.......))....))))..))))).(((..(((((((((.(((((((((((((.((((....((((((.((.((...((...))...))..)).)))))).....((((((((.((((((((((.((((.(((....)))..(((((.(((....((.........))...)))))))).(((......)))(((...............)))..((((.((((((((...(((((.((.....)).(((.....)))...))))).))))).....))).))))..)))).)).)))))))))))))))).....(((((.((((......(((((((.((.(((((((......))))))))))))))))..((((.....))))..)))))))))))))))))))))).)))))))).)))))..)))(((((((...(((.....))).............)))))))))).))))))))).))...(((((.(((((((((.(((.((.(((....((((((....))))))....))).)).)))...)))).)).))))))))((((((..(.(((....))).)....))))))(((((.((((.......))))..)))))....(((((...)))))...((((...(((((((((....))).........((((((..((.((((...))))))..((((..(((((((.....((((((....))((((..(((.((...(((..(((((((.(((........)))))).))))..))))).)))..)))).)))).....))))))).)))).)))))).)))))).))))..)))))).)))))...))))).)).))))....))))))))))))))))))))(((((.((.(((.(.(((((.((((((((((.(((....)))(((((((((((((..(((((((.....((..........)).....))))))).))).)))....)))).))))))))))))))))))))))..))...))))).......((((((((.(((((.(....(((((.............))).))...).))))).))))))))((((((((((((..(((((..(((((.((((((.((((.(((((((((((.......((((((......))))))..)))))))))))....)))))))))).)).)))..))))).)))..(((((.((((((((......((((...((((((...)))))).))))...)))))))).))))))))))))))..................))))))))).))))..
Thermodynamic Ensemble Prediction
...{{,{((((....,,}))}||},,,..((((.({{(((((((..((((((....(((((((.....((((((.(((.((.(((......((((((((....))))....))))..(((((.((((((.((..((((((((.((....)).)))))))).,)})))))).))))))))))))))))).))))))))))))))).....)))))))(((((((.(((((((.(((.(((((((((((((((({{((.((((((....)))).(((((((...)))))))(((((({({((((((..........))))))))))))))))))))))))}..(((((((.((((((((((((.((...)))))).))))......)))).)))))))..)).))))))))....((((((..,{......}}..((((.((((((((.....))))..)))))))).)))))).,..))).)))..)))).)))))))...(((((((.(((((((.((.(((((((.((((...((((((.(((((,.(((((..((((((...{(((((((((((((........((..((((((....,.((((........)))).,....))))))..)),(({{..,,,}}}}((((.....))))(((((((.......)))))))....(((((((((..{(.......))....))))..))))).(((..(((((((((.((((((((((({{{((({....{{{(((.({.({.,.{....||{{{||.||)|}}}|||{.,,.(((({{{{.(((((((({,.{{{{.|||,.||||||,{({{{{,{{.|,,,.........,,}...,||||||}.||{...,.,|}|(((...........,...})},.{{|||||{((({{..,|{{{{,((,....})|({(,,,,,}|}..|}}|||,|}}}}....{||...}}}..}))).)),)))))})))}))}})),,,,.{{|{(.{{{|,...{.(((((({{((.(((((((......))))))))))))))))}.{{{|...,,))}),,))))})))))))))))))))))}}))))))).)))))..)))(((((((...(((.....)))............,)))))))))).))))))))).}}...(((((.(((((((((.(((.((.(((....((((((....))))))....))).)).)))...)))).)).))))))))((((((..(.(((....))).)....))))))(((((.(,(({,.....})))|.)))))....(((((...)))))...{{{(,,.{((((((((..,{({{(((({{((.,(((((...,{((((({{((({....{,,|,.(((({|{{{{,.({{,,,,}})))}})))){{{,,.,..(((...,))},|.|||}},..}}})))))).,}),..))))))))},))))..,,,|,,{..,,...))))},.,)))))))))))))})))}..)))))).))))).,.))))).)).))))....))))))))))))))))))))(((((.((.(((.(.(((((.((((((((((.(((....)))(((((((((((((..(((((((...,{{(.........,}),,...))))))).))).)))....)))).))))))))))))))))))))))..))...))))).......((((((((.(((((.(....(((((.............))).))...).))))).))))))))((((((((((((..(((((..(((((.(((((,,((((.,,((((((((({...{{.((((((,....,)))))).,)}}},))))))}}}.)))))))))).))))))..))))).))),.(((((.((((((((......((((...((((((...)))))).)))).,.)))))))).)))))})))))))).,,,...........,,,)))))))}).))))..

Transcripts

ID Sequence Length GC content
AUUGGUCGGCGUGCCGUCGCCCCGCUGGAGGGAGGACUCAGGCCCCGCU… 2044 nt 0.6008
Summary

Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.