| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACUGACUGGGCAGCCUUUCAGGAAAGAUGCAGCCACUCCUGCUUCUGC… | 914 nt | 0.5591 |
The protein encoded by this gene, a member of the peptidase S1 protein family, is found in azurophil granules of neutrophilic polymorphonuclear leukocytes. The encoded protease has a specificity similar to that of chymotrypsin C, and may participate in the killing and digestion of engulfed pathogens, and in connective tissue remodeling at sites of inflammation. In addition, the encoded protein is antimicrobial, with bacteriocidal activity against S. aureus and N. gonorrhoeae. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CTSG is a candidate forensic biomarker of hypothermia, showing a 5.278-fold upregulation in lung transcriptome analysis following hypothermia-induced death [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. In human burn injury research, the CTSG was identified as a significantly up-regulated immune-related gene and validated as a potential biomarker in patient blood samples [Niu et al. DOI:10.1093/jbcr/irad050]. A study in mice demonstrated that the CTSG is a defining granule gene for a neutrophil-like monocyte cluster enriched following clodronate pre-treatment and controlled cortical impact brain injury, with its expression increased in whole blood monocytes [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].