| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUUUGCUGCCGAAACGAAGCCAGACAACAGAUUUCCAUCAGCAGGA… | 1629 nt | 0.4598 |
The protein encoded by this gene is a lysosomal cysteine proteinase involved in bone remodeling and resorption. This protein, which is a member of the peptidase C1 protein family, is predominantly expressed in osteoclasts. However, the encoded protein is also expressed in a significant fraction of human breast cancers, where it could contribute to tumor invasiveness. Mutations in this gene are the cause of pycnodysostosis, an autosomal recessive disease characterized by osteosclerosis and short stature. [provided by RefSeq, Apr 2013]
A study in humans demonstrated that the CTSK gene was upregulated during long-term weight loss (0 to 12 months) in weight losers within subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245]. In a separate review of human and murine skin wound healing, the CTSK protein was identified as one of three key genes specific to hypertrophic scar fibroblasts, indicating its potential as a biomarker for hypertrophic scars [Cheng et al. DOI:10.1093/burnst/tkae043].