Basic Information

Symbol
CUBN
RNA class
mRNA
Alias
Cubilin IFCR Gp280 Cubilin (Intrinsic Factor-Cobalamin Receptor) Intrinsic Factor-Vitamin B12 Receptor Intestinal Intrinsic Factor Receptor Intrinsic Factor-Cobalamin Receptor 460 KDa Receptor MGA1 IGS1 IGS
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Chronological age estimation

MANE select

Transcript ID
NM_001081.4
Sequence length
11927.0 nt
GC content
0.4652

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3650.80 kcal/mol
Thermodynamic ensemble
Free energy: -3878.04 kcal/mol
Frequency: 0.0000
Diversity: 3072.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((((....)))))).....))))))((((((((((((((.......(((((((..(((((((((((..((((((............((((((....)))))))))))).))))))))...)))....))))))).........)))))))))))...((((......)))).)))..(.((((((((((.(((((((...(((((((((((((....))))))......(((...((((((................(((((.(((((((...))).)))).)))))....((((...(((((((((........((((((..((((((.(((...((((((((..........(((..((((((((((((((((......)))))))))))).)))).)))..(((((((((.((((.(((((((.((.....)).)))))))....)))).)))))...))))))))).)))))))))..)))...)))))).))))))))).))))..(((((((((((((((((((...(..(((((.((.((((((((.(((((.......((((((......))))))((.(((...))).))))))).)))))))))).((((.(((.((....)).))).)))).)))))..)...))))))......(((((((.....((((.(((((....(((((((.((((..(((...(((((...((((....))))...))).)).)))..)))).)))))))...)))))...)))))).)))))((((((((....))))))))...((((.(.(((...((((.((........)).))))...))).).))))...........((((...(((((....))))))))).....)))))))))))))((((....(((((((((((..((((.........)))).......((((((..((.(((......(((((...)))))......)))))..))))))(((((....))))).((((....)))).))))).))))))....))))...))))))...)))..(((((....))))).(((...((((.(((.((((...((((((((((((((...((((((((.(((.(((((((((((((((....((((((..((.(.(((((((((......((((..((((.(((((((((...(((((((((..((...........((((..(((((..(((((((....))))).......(((...)))(((((((.(((((((........(((((((((((((((((((.((((((.((.((((((......))))))(((((...((((((.((.(((((((((((((((.((((((((.((((((.(((((((((....))).....((((..((((((((.(((((...((((((..(((....))).(((((...)))))))))))..)))))))))))))...))))((((((((.((.(((((............))))))).)))))))).....))))))(((.(((((((....................))))))).))))))))).))).....))))).)))))))))))))))(((((((((.(((......((((((............))))))......(((....)))))).)))))))))..))))))).)....))))).....((((.((((..((((.........))))..)))))))))).))))))...((((((......(((....(((.(((((((...((.(((((.......)))))......(((.((((((....)))))).))).....(((((.(((((.((((((.((((((.......)))))).))).((((((((..........(((((((((((((((.((.(((((((..((((((((((((((((((.(((((...))))).)))).))))))..((((((.(((.....)))..)))))).(((((.(((.((((...(((((((((((....((((......))))((((((.((((((((((((((.(((((.((((..(((((((((((.................((((((((((.((((...((((((....)))))))))).)).))))))))((((.........))))(((((((..............))))))).(((.((........)).)))...((((((((((..........(((.....(((((.((((((((((..((((((((((((....(((((.......)))))((..((((((((....((......)).....(((((....)))))))))))))..))...............((((((.((((((.(((.(((..((((((....))))))...))).)).).))))))))))))......)))))))..((((((((......(((....(((((............(((((((((.............))))))))).......((((((...)))))).)))))....)))..))))))))((((((....((((.((((....(((.........)))...)))))))).....))))))..)))))))))))))))..))))).....))).........(((((((((((......))))...........((((((((((..............((((....)))).((((((((.(((((((..(((((....))))).....)))))))..))))))))(((((.((((...(((((...))))).....(((((........))))).....)))).))))).....((((((((((........(((((........).))))...((((....))))......(((((...)))))((((...(((((((((.......((((.((((..((....))..)))).)).)).......)))))).)))..)))).)))))))))).(((.(((...((...((..(((((((((.(((((.(.....).))))).)))))))))..))...))...)))))).(((..(((((.((......)).)))))..))).(((((((......)).)))))....))))))))))..(((((((..................)))))))......(((((.....)))))........(((((....((((....)))).....))))).)))))))...........)))))))))).))))))).))))..))))............))))).....((((((((.(((((((((...((.(((....)))))...))).))))))..................))))))))((((((.....))))))..............(((.(......).)))..)))))))))((((((....)))))).(((.((((....(((((.(((((((....(.((.((...)).))...)....))))))))))))....)))))))....(((((((((.((((((((((((....(((((((((..(((((((.(((((((((((.(((((.((...)).)))))((((((((.(((((.....((((..((((.....)))).))))...))))).(((((((((...(((((((((((...........((((((((((((.......))))))))((((((((((((.(((.((((........(((((..((((((...(((.((..((...(((((....)))))....)).)).)))...((((((((((......((((..........)))).......((((((.(((((......)))))))))))...........((((..(((((...)))))))))..((((......))))......)))))))))).)))))).)))))......))))...)))))))))........))))))((((...))))))))))))))))))).)))))).))).((((..((.(((......)))))..))))..)))))))).))))))))).(((((........)))))..)).)))))).)...)))))))))...)))))))..))))).)))))))))((((((..(((((((((((((((((((....((.((((((((.(((((..(((((((.(.((......)).).)))))))........))..))).)))))).))(((.....)))......(((.(((.((((.((...(((((......))))).)).)))).))).)))(((.....((((((..(..((((((...(((((.((((((((..((((....(((((.((((.((((((((((...(((((..((((((..(((((........((((.(((.........))).))))(((....)))((((((.((((..((((((.(((..((((((((((((((((((((((((.((..((((((((((..(((((((.....)))))))....((((.((((((...(((((((........))))))))))..))).))))..........((((((((((....))))............(((((((.....))))).)).(((......))).))))))((....))((((((.(((((.((...))..))))))))))).))))))..))))..)).)))))).....((((((((........))))))))..(((.((((((.....)))))).)))....((((((((.........((((....)))))))))))).........((((((((((((((..(((((.........(((.....)))........)))))))))))..)).))))))...........))))))))))..................(((((((.............))))))).(((((...)))))..)))))).............((((((((((((((..((((.(((.......)))))))..))))))..)).......))))))..............))...))).))))))))))....((((((((.(((.((..((((.((((((((((...((((((((((..(((....)))..))).)))))))..(((((((((((((((((((....))))...))))((((....))))...............)))))))))))....(((((.......))))).((((...)))).((((((((...............)))))))))))))))))).))))..))..))).))...))))))....((((((....(((((((((.((....)))))....))))))....))))))))))))........)))))..)))))).....)))))))))........)))))).)))))))))..))))...))))...((.((((....(((....)))..))))..))....)))).))))).....)))))).)..))))))....)))(((.((((..(((((((((((.((((((((((((.((((((....((((((.......))))))))))))))))))....)))))).((..(((((.((.............)).))))).))...........)))).))))..)))..)))).))).))......)))))...))))))).))))))).((((.((((((.....))))))))))..(((....)))............))))))........)))))))))))..)))))))))))..)))).))).(((((((((((((.......)))))).....)))))))..)))))((((.((((.(((.((((((.(((....))).)))))).))).))))..)))))).))))))..........))))..))).)).))))))...))).))))))...))))).))).....))).))))).)))))((((((((..((((.((((.((.((...((((.(((((((..(((..(((((.(((........((((((((.....((((((((.(((((.((.((.......(((((..((((((.((((((((............((((........))))))))))))..))).)))..))))).......)))).)))))))))))))..((((((((((..........(.(((((......))))))))))))))))((((.....(((((((((((...(((...(((....(((((((.....(((((.....)))))(((((.((...)).))))).((((((((.(((....))).....((((((((.(((((.......)))))))).)))))..(((..((((.(((..(((((((((..((((.(((((((((((....(((((....)))))..))((((((((.((((((((.......)))).....((((.(((((((..((((((.(((....))).))))))))))))).)))).............((((..........)))).((((((....(((.((((((.....((.......))..)).)))))))..))))))((((((((.....((.((((((((((((((.....((((((......((((((....((......)).....))))))...(((((......)))))....((((((.((......))))))))......((((((((((..((((.(((....((((((((((...(..((((((......((.(((((..((((((...))))..))..)))))))))))))..).))))))))))..))).))))..))))...(((((....)))))..))))))))))))......))))...)))))))))).)).....)))).....)))))))).)).))))))(((....))).(((((....((((((........)))))))))))....))))))))).)))).))......((.(((((....((((((((........))))))))......))).)).))..........)))))))....)))..)))).))))))))))).....((((..(((.(.(.(((..(((((((((((((((.(((((...((((((((.....((.(((((((((((.((((((((....)))))))).......(((((((((......))))))))).(((.(((.(((((((((.((...(((((((.........(((((((......(((...((.(((....(((........)))((((....((.((((......)))))).)))).))).))..))).......))))))).....))))))))).))))))).))..))))))....((((((((..((((((..(((((((((..((((((((.((((....((((.(.......).))))...)))).....................((((((((.......((((((......)))))).(((.((((((..(((((((.(((.((((((((.............)))))))).)))...)))))))))))))..)))......))))))))......))))))))...((((.(((((.(((((((..((......))..)))).))).))...(((((..(((...((((.(((((((...(((((((((((((((((((((.((.(((.((......((.((((.....)))).)).....)).))).))))))...))))))).))))..)))))).))))))).))))....))).))))).))).)))).....))))))))).(((((((.......)))))))(((.((((((((((((.......((((...))))..(((...)))......(((((((.(((((...))))).))))))).....)))))))...))))))))..........))))))...))))))))...))))))).)))).)).......))))))))((((.....)))).((..((((...((((.....))))...))))..))...((((..((.....))..))))..)))))..)))))))))))))))..))).).).))).)))).(((((.......)))))............)))))))....))).)))((((((...(((.((((.(((........)))))))(((((((((...))))))))).....)))...))))))...........)))))).)))))....))))..((((((((((((((.........((.((..((((..(((...(((((((...(((((.(((((.((((((.((((((((((......)))))((((((...((..((((((((((......(((..(((((....)).))))))...))))))...))))))....)))))).(((...(((.(((((.(((((..((((((((..(((.(((((.(((((.((((.((((...)))).)))).))))))).)))...........((((.((((........))))))))...))))))))))).))))).))))).))).)))...((((((....))))))))))).))))))..)))))...........................((((.(((..(.((..(.(((..((..(((((((.....)))))))))..))).)..)).)...)))))))((((......))))........)))))..)))))))))).))))..)).)).)))).))))))))))(((...(((..(((.((..((((((.(((....))).))))))..)).)))...)))......)))...))))))))((((.(((((...............)))))))))((((((...(((.........)))(((((((.....)))))))((((((..((((..........))))..)))))).((((.(((..........)))))))..................)))))).....))).))))).)))...))))))).)))).)).)).)))).)))).))))))))))...)))))))))).)))))))))))).)))))........((.(((((....))))).))......((((((.......(((.((((((((((((((((((........(((((((.......)).))))).)))))...((((((..(((........((((.....)))))))..))))))...))).).).)))))))).)))))))))(((((((((.((((....((((((......((((((((((((((..((((......)))))))......................(((((...........)))))(((......((((((((((((.((((.((......(((((.((((..((.....)).))))))))).((((((...((((((((((..((((...(((((((...((((....((.......))(((((.(((((((((.((((.(((...((((((((((.(((((..((.(((.((.((...((......))...)).)).))).))..))))).)))))))..............(((((.((.((.....)).)))))))...........))))))))))..))))))))).)))))))))....(((((((((((((((((..........))))......))))))((((((((...(((((((((((((((((.......(((.((((....((((((((....(((...((((.(((((((((..............(((((......)))))...((((((...)))))))))))))))))))...))).))))))))((((.(((..(((((......)))))..))).)))).....(((..(((((((((.........))))))))).)))(((((.....((((.((((.((.(((....((.....)).....))).)).)))).)))))))))(((((((((((.....................(((((((...((((((......................(((((((((((((((((((((((.((((..........)))).)))))).))))).........)))))...))))))).)))))).)))))))..........((((.(((..((...))..))))))).....((((((((..........((((..((((.((((((((...((((.........))))..)))))))).))))...))))..(((.((((((((((...))..))))))))..)))....)))))))).((((........))))..)))))))))))......)))).)))...(((.(((((((((((((.(((.((((..((.((((((...((....))....))))))...))..)))).))).))))))(((((((((((...(..(((((...........)))))..)..))).))).))))).......(((((....((.((((((.((...(((...)))......)).)))))).)).....))))).............((((((....((((((.((((((..((..(((.(......).)))..))...))))......))))))))....))))))......))).)))).)))..(((..(((...)))..))).......)))))..)))))))))........(((((.....)))))(((((((......))))))))))..))))))))...(((.((((((((.((((..((((..(.((((...((((((.....(((..((((......))))..))).)))))).)))).)..)))))))))))))))).)))))))))).)))))))....))))..))).)))))))...)))))))).))))))).(((((.....(((((........)))))..))))).))))))))).....)))))))))))))).....)))))).))))...))))))))).))))))))))).((((.((.......)).)))).............))))))).)))))))..........((((((((....((....((((......))))....))..))))))))(((((((((.........))).)))))).......((((((...))))))))...)))))..))))...))..)))))))))...................(((...)))..))))))))).))))....))))....)))))))))).))..)))))).......))))))).))).)))))...))).))(((.......(((....((((((((...)))))))).....))))))))))))))))))).))....(((((....)))))((((..((((((.(((((.(..(((((..((((...........))))..)))))..))))))...)))))).)))).)))))..)))).)))))))))))))))))...(((....)))...((..(((.......)))..)).......))))))))))))))))).)...(((.(((((.((.(((((....)))))))))))).)))...
Thermodynamic Ensemble Prediction
.((((((.((((((....)))))}.,}}.))}}}}((((((((((((((.......{{(((((..{(({(((((({,,((((((,.,,.......,{((({{....)))))))}}})).}}))}}}}...))),}.,)))))}).....,...)))))))))))...((((......)))).}}}..{.((((((((({{(((((((...(((((((((((((....})))))......(((...((((((................(((((.(((((((...))).}))).)))))....((((...(((((((((..,,,,({{(,.,,..,,,(((.(((...{{{{||||},........|||..{{{{((((((((((((......)))))))))))),|||},|}}..,|||||||({{(((.(((((((.{(.....}}.))))))).}}}))||,|},||,,{||.|||}||,.,})))))),.)))}})})))},)))))))))).))))..(((((((((((((((((((..,{{{(((((.({.((((((({.{((((.......((((((......))))))||,((|...,)),)}))))}.|))))}))}}.{(((.(((.{(,...||.})|.}))}.}}}}}..,...))}}}|{((((((((,,{{.,,,.((((.(((((....(((((((.((((..(((.{.{{(((.,.((((....))))...})).,).)))..)))).)))))))...)))))...))))}},}}}|}((((((((....)))))))).,|{{...|.,||}}}||||},|}}.},|||,}},}})}}}),},..||||,,,|},.,||,},,)}}.(((((....)))))}}}))}}),)))))))))))))((((....(((((((((((.,((((,,....,,.)))).......((((((..((.(((......{((((...})))}...}..)))))..))))))(((((....})))).((((....)))),)))))}})))))....))))...))))))...)))..(((((....))))).{{{...((((.(((.((((...((((((((((((((...(((((({{.(((.(((((((((((((((....((((((..{{,(,(((((((((,,....((((..((((.((((((((...,.((((((((,.({{.,{{,,...,))}...}}},,,...(((((....))))),,))))).,,{(((((((((((((((.((((,,,{.,{.(((((((((((((((((((.((((((.((.((((((......))))))(((((...,((({{{((.(((((((((((((((.((((((((,((((((,(((({{{((,...},}},,|{{{((,.((((((((.(((((...((((((,.{({....})).(((((...)))))))))))..))))))))))))),,.}))}((((((((.({,(((((,{{{...}}}}.))))))).)))))))).,,..}}})))|{{,(((((({,.....,.....}....,}}}}))))),}},}))))).,}||||..}}))).)))))))))))))))(((((((((.((({.....((((((,..........,))))))......{((....)))))).)))))))))..))))))).)....))))).....,{((.((((,.((((.........))))..))))))},)).))))))...((((({.....,(((....(((.(((((((...((.(((((.......)))))......(((.((((((....)))))).))).....(((((.(((((.((((((.((((((,....,,,))))).))).((((((((..........(((((((((((((((.((.(((((((..((((((,.((((((((((.(((((...))))).))))}})))))..(((({(,(((.....}||,,||}}}}{(((((.{((.((((...(((((((((((...{((((......))))|{{{((.(((((,{{{{((.{.{{{{{.((((..(((((((((((.................((((((((((.((((...((((((....)))))))))).)).)))))))).,,,...,{{{{{|,||(({,(((,.....,...,}.})))))))}{((,((.....,,,)}.))}...((((((((((..........,,,.....(((((.((((((((((..(((((({{({(({{{.{,((({{{,...||,||,{{{(((((((({,,.{{...,,,}}..,,}|{{{{,.,,||||||}|||||}.....,,..{((((.{(({...|)))..})))},.|||{,..,{{|||,}.,))))))}..,,|{||.,.,,,,}))))}}},..|,,|,,,}}}},((((({({{{...,{((.,,,(((((.........|..{{{{{{(((..........,..))))))))).,,.,..((((((...)))))).}))))....)),.))}))))))|||{{{,}}}||||}|||}},..|{|,,}}}}}}.,,)}}}).)||||,....,))),},..)))))))))))))))..))))).....})).........|||||{,((({......))))...........((((((((((......,,,.,,,,((({....)))}.{(((((((.(((((((..(((((....))))).....)))))))..))))))))(((({.{(({|,.{((((...)))))...{,(((((........)))))},...}))).})))).....((((((((((........{((({,.......),)))}...{(((....)))}.....,{((({...})))}|(({...(((((((((.......((((.((((..({....))..)))).)).)).......)))))).)))..}))).)))))))))).(((.(((...((...((..(((((((((.(((((.(.....).))))).)))))))))..))...))...)))))).(((..(((((.{{......}}.)))))..))).{(({(({......})}})))}.,,.))))))))))..(((((((..........,,,,,,..}}}}}}}......(((((.....))))).{{{{{{.(((((....((((....)))).....))))).},))))),..........}))))))))).))))))).))))..)))).......{,...})))}...,,{((({((({({{{(((((...((.(((..,,||}||||.}}|,|}}|||,...,,{,,{{{{..,,{{|,,}},|((((((.....))))))}...........|,{(({{{...{{(((.....))))),,.{(((((....)))))).{||||||,....|||||.|||||||..,.{.((.{{...}|,||...|,...}}}}}}}}}}}}..,.((((((((({.{(,{{,.((((((((((((,,(((((((((..,{{.{(((((,,..((((({({,.{{((.{{{{|..,.....,,((((((((..{,({{...({(,{{,,,.,..,,,.|||{{||....,))))})}}|)}}|,...{,(((((((,,..{((((,(((({((((,{,.....,}}},,||||||,{{{{{{{{,,||{{,...}})))}}}}},))))),,)})))))|}||||}...}}}.,,,))))))))}})))}}.}}))}}}}.}}})),,,.})))))..,,|}}}}}}..,}}..)))))).})))||,|||}}||||}}}.{,||||||,||||{{....,,,..{(((..(((((...))))))))}..{{{{......|||||,,{.,|.||||..,,{{{{{{{{,,{{{..,,(({,.....{{(((({{{((......{,|,||,||||},||..|||,,,}}}})))},}}}}}))))))))))).{{.(((((.{{.{(((((((,{{{{((({...)))))..,))),)}}}}}}}...)}.))))).})}.}},)))}}...}})}}))))},})}))))}.,))))}})))}))))||{{({{,.(((((((((((((((((((...,((,(,((((((.(((((..(((((((.(.((......)).}.)))))))........))..))).)))))).||(({.....}}},....((((.(((.((((.((,..(((((......))))).)).)))).))).)))|{{....,((((({..,,,{{(({|...(((((.{{((((((..,((({{..(((((,((((.((((((((((...(((((,.((((((..((({{..{,,,,,((((.(((.........))).)))}{{{...,|}|(((({(..{{...((((((.(((..{{((((((((((((((((((((((.((..((((((((((..(((((({.....}))))))....{(((.{({{{,..,(((((((........))))))))}}.,,}}.)))}.,,......,(({{({((((....))}}.,,{..|,....{,{{{{{.....))))).,,,{||.,...,}.}}))))))|{....},((((({,(((((.((...))..))))))))))).))))))..))))..)).)))))}.....((((((((........))))))))..{((.((((((.....)))))).))}....((((((((.........{{{{..,,)))})))))))).........((((((((((((((..(((((.........(((.....)))........)))))))))))..)).))))))..........,))))))))))..................(((((((.............))))))).(((({...}))))..)))))).{{,.{,......((((((,(((((((..((((.(((,....}.)))))))..)))))).........,,))))))..............}|,|,))).)))))),,,||..|,}}}}},),}||}||.,||||}|||((((((((((((,,{{{(((.{(((...,|||,.|||||||||||{,{({({{{{(({((((((((....)))}..,}))){{((....||||,,,,...,,,.....,})})))}}))}})}||{{,...,,,,|}}}}.||||}..}}}}|((((((((...............))))))))}}}}||||||||||},.|||||,..,}))))})|||||{|||,||,...,|||||||||,||.,}})))))....,)))))}}}})))},}}}}}}}.....,,.}))))..))))))...,.)))))))))........)))))).)))))))))..))}}}}.))))}..{{.((((.,,.{{{...|}},,.))))..|}....}))).))))).....}})||},|..}})))}.,,.,,}|||}})||..||||{{{{{{..(((((((((((,,((((((....((((((.......))))))))))))))))))....)))))),}}}.{{{{{,,,..........,}}}).||,,,.........,,.,,}}}}.|((({...|....,,.))},))}},...)))))...))))))).))))))).(({{.{{{||{.,,..))}}|}}}}}..{{{....)))......,}}}}.}}}},,..,,},}}))}))))))))..)))))))))))..)))).))).(((((((((((((.......)))))).....)))))))..)))))||||.|||(,(((.((((((.((,....))).))))}).))).})))..))))}},}}}}},}}}}..,,..))))..))).)).))))))...))).))))))...))))).))).....))).))))).)))))((((((((..((((.((((.((.((...((({.(((((((,.{{(..(((((.({{...,,,.,((((((((.,,..((((((((.(((({.{({(.({{,..{(((((..((((((.((((((((............((((........))))))))))))..))).)))..)))}}}}..}.}))))})))))))))))))||((((((({((..,,,.....{.(((((......)))))|}|||}}}|||((({.....((({(((((({...{{(,.,{{({,..((({(((,{,,.{({((...,,))}}}(((((.{{...,).))))).,((((((({(((...{|||{..{{((,(((((.((((({{{{,,.},}|}}},.||||,,{{((,,,(({,..,{,{{{{{{,,,..((((.((((((((({.....(((((....))))).,|{{(((((((.(((({{((,,,....}))),....((((.(((((((..((((({.(((....))).})))))))))))).)))).....,.....,,((((.,,....,,.)))).((((((....(((.((((((,....((.......)),,)).}))))))..))))))((((((((..,,.((.(((((((((((((({.,{{((((((,.....((((((....((......)}.....}))))),,,(((((.,,,,.}}))),...(((((,,((......))))))))......{{{{{||{||,,|{{{,{{|,,..|(((((((({...{..(({{((......{{,((({(,.,,,|||,,.))))..}),,}}}}||})))))),,}.}))))))))),}))).}))),.))))...(((((....)))))..}})))))))})}...,..,}))...)))))))))).}).,,..))))....,)))))))).))}}})))}{{|,,..))}.{{{{,...{((((((........})))))))))),..,))))))))).)))),))},,.,,}}.,|}}||.||||{(((((........)}}}}}}}}}})))))).}))}}..))),))))))))))))}))))).........,}})))).......{(((..(((.{.{.(((..(((((((((((((((.{((((..,{(((((((.....((.(((((((((({,((({(((({{{.},||||,|,{{{{{{(({(((({(,,,.,,|}}}}))))}||,||||...({(({(({(({,,,(((,(({.....,{{({,,{,,......{,||,,,{.||||,..{|,.,}}}}},),)|||({{{{((.((((,.....)))),|{{|...)))..,}}))}},.....,,}}},,.....)))))))),,),))))}.,))))}})).....((((((((..((((((..{((((((((..((((((({.((((....((((.(.....,.).)))).}.))))............,,......{((((((((.......((((((......)))))).(((.(((((({.,((((((.(({.((((((((.............)))))))).}))..,))))))))))))},.)))......))))))))}.....))))))))...((((.(((((.(((((((..{{......,,..))))},)).))...(((((,.(((...((((.(((((((...(((((((((({((((((({{((((.(((.{(,.....{{.((((.....)))).}}....,)).))).)))))}...))))))).))))..)))))).))))))).))))....})).))))).))).)))).....))))))))}.(((((((.......)))))))({,{((((((((((((.......((((...)))).,{({...,,},.,...(((((((.(((({...})))).))))))).....)))))))...))))))})..........))))))...))))))))}}})))))))))})).)).......))))))))((((.....)))).{,..((((...((((.....))))...))))..,}...((((,{((...,}))..))))..))))),.)))))))))))))))..))).}.}.))).)))},(((((.......)))))|...........))))))}....,})}}}}({{(((...{({{((((.(((........)))))))|{{((({((..,)))))}}}|....,))}...)))))}.|,,...,,..}))))),)))))....,})).,((((((((((((((.....,...{{.{{..{(({..({(...{((((((...(((((.(((((.((((((.((((((((((......)))))((((((.,.((..((((((((((......(((..{((((....)).))})))...)))))),..}))))).}.,)))))).(((...(((.(((((.(((((..((((((((..(((.{{(((.(((((.((((.((((...)))).)))).)))))))},)}...........{({{,((((,.......}))))))}...))))))))))).))))).))))).))).)))...((((((....))))))))))).))))))..))))).........................,{({{,....,,,,....|.{{,..||||{{(((((.....))))}}}}},,))},,,,,}|||..,,}})},{{{{......))))........)))))..))))))}})).}}}}..}),)),)))).))))))))))||,...|||},{||}||}}||{{{{.{{{....|}|,|}||||,,|}.}}}.,.}})},}}.}}}}...))))))))||||.(((((...............))))).,,,{{((((,,.({{...,.,,,.}}|(((((((.....)))))))|(((((,,{{{{...,,.....}))),,))}))).(((,{(((.{,....,}.))))))).......||.,{{{{,..}}})))}},.,))).))))).))).,.))))))).}))).)).)).)))).)))).))))))))))...)))))))))).)))))))))))).)))))........((.(((((....})))).))....,,{{{{{||......(((.(((((((({,(((((({{...,,,..((((({{.......}}.))))).}))))...{(((((..(((........((((.....)))))))..))))))...))).}.,.)))))))).)))}))))}(((((((((.((((....((((((......((((((((({{{{(((,(((,,{{((,.,,,}},},,.,,,...,,,,,....,,(({{{,,,..,,....})}}},.}},..,.(((((((((,((,((((.{(......(((((.((((..((.....)).))))))))}.{{((((...((((((((((..((((...(((((((...{{,,....{{....,{{|,(((((.(((((((((.((((.(((...((((((((({.(((((..((,{{{..,,{{,,,{{......,}.,.}),)).}}..))..))))).})))))).....,,.......(((((.((.((.....)).}))))))...........))))))))))..))))))))).))))),,,,|,,,{{{{{({((((((((((..........))))}.....})))))((((((((...(((((((((((((((((.,.....{({{{{(({,..{{{(((({....(({...((((.{((((({{,......,,,..{,{(((((,,,,,,|}|||,{{(((,{,...,,,,,,}))))))))))}}...}||,||}}}}}|((((,(((,.(((((......))))).,|}},|||{{.,.,{{,,,(((({((((.......{{|||||,,,,.,)))}}}}.....{{{|}||{|}||}|{{....|{}},,,),.,,,}))),}}}))),.}}}}}}})}(((((((((((.{...........,,{,....(((((((...((((((,{{...,,,..,.{|,......{{{{{{{{{(({(((({((((((,({({..........}})).)))))).))))).,,.,,,,.))})),,,)}}}))).}))))).))))))).,||,,..|}{{{,|||{..||,,.})..))))))).....((((((({..,,,......|||..{(((.((((((((...((((.........)))),})))))))).)))}...||}}..{{{.{(((((((((...}}..)))))))}..|||....)))))))).((((........))))..))))))))))),.....|||,.,,....,{{.|||||,|}|||||,||}.{|||..{({((({(({,{{(,,..,,.,,.|||||}..{||{{||||.}}}.}},,,}(((((((((((...(..{((((...........)))))..}..}})}})).)}))).......||{{{....((.((((((.((...{((...}}}......)).)))))).)}.....))))}.............|{{{|{....(({(((.{{,,{{,||{.,(((,(.....,)|)))..||..,}}})|,.,,..,}})))),...)})))}....,,}}}})))).},)},||,|}||...,)))},}}}.,.,.,.))),,,})))))))))..,{{...,,,,,,,,..}}},|(((((((......))))))))))..))))))))...{{{.((((((((.((((..((((..{.((((...{(((((,...,(((..{{|{,,,,..})))..}}}.)))))),)))).)..)))))))))))))))).)))}))))),.)))))))....))))..))},,))))))...)))))))).))))))).(((((...,,{((((........)))))}}))))).))))))))),....)))))))))))))).....)))))).))))...))))))))).))))))))))),((((.((.......)).)))).......................,,{,,,{,......{((((({,,.{..((....((((......))))...,)}..))))))))},{{{{{{{.....,,||)}}.})}},|,,,,...,{{|||,,,,}))}|{||{{||,,|{||}{....,},.}})))))))}},....,,.}}}}.}))))))))))))))))))))))).))))..,.)))).},.)))))))))),))..))))))...,...)))))))}}))}})))).,,|||.}}|{{......,|,.....((((((({...})))))))......,,)),))))))))))))).))....(((((....)))))((((..((((((.(((((.(..(((((..((((...........))))..)))))..))))))...)))))).)))).)))))..)))).)))))))}))))))))).,,{{,....,}}...,,..,,{.......))}..,,.......))))))))))))))))),|,..{((,(((({.{{.{{{{{....}})))))))))).,)),..

Transcripts

ID Sequence Length GC content
AGUUGGUUGGAGUGGCCUCACUCUUACCUGCCAACCUGGGAGGUUGAUG… 11927 nt 0.4652
Summary

Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]

Forensic Context

A review of human multi-omics studies for biological age estimation identified the CUBN as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in humans demonstrated that the CUBN exhibited a Gini impurity score of 0, being present in most pure urine samples and in mixtures containing urine while being absent in mixtures without urine, establishing it as a discriminatory protein for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].