Basic Information

Symbol
CXCL1
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 1 SCYB1 NAP-3 MGSA-A GROa GRO1 MGSA Chemokine (C-X-C Motif) Ligand 1 (Melanoma Growth Stimulating Activity, Alpha) GRO1 Oncogene (Melanoma Growth Stimulating Activity, Alpha) Melanoma Growth Stimulating Activity, Alpha Neutrophil-Activating Protein 3 Growth-Regulated Alpha Protein Fibroblast Secretory Protein C-X-C Motif Chemokine 1 GRO-Alpha(1-73) FSP GRO1 Oncogene (Melanoma Growth-Stimulating Activity) Melanoma Growth Stimulatory Activity Alpha Melanoma Growth Stimulatory Activity MGSA Alpha GROA GRO
Location (GRCh38)
4:73869392-73871308
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Wound age identification Sudden death from CNS diseases Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001511.4
Sequence length
1174.0 nt
GC content
0.4540

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-336.40 kcal/mol
Thermodynamic ensemble
Free energy: -361.30 kcal/mol
Frequency: 0.0000
Diversity: 320.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((...))).))(((((.(((((((((....((((((..(((..(((((((.(.(((((((.((.((..((((.((((((((......((((..............))))....(((((((((...)))))))..))....))))).))).)))))).)).))))))).).)))..))))..)))......((((((((((..(((((...)))))(((.......)))....((((.....))))....(((..((((...))))..)))(.((((((......(((.........)))......)))))).).(((((.((((..((((.......................((((.....))))(((..((((..........))))..)))..)))).)))))))))))))))))))((((((((.(((.(((...)))))).))))))))..)))))))))))(((((((...(((.(..((....))..).)))....)))))))((((...))))(((((....)))))..............(((..((((((.....(((((((.(((((...(((((((...........(((((.((.....))))))))))).)))...))))).....(((((((.(((((((((((((((...((.((((....(((((((.......(((((((((.......)))))))))(((((.(((....(((....)))...))).))))).........(((((((.(((...))).)))))))))))))).......(((((..((((.((((((((((((((((((((((.((..(((((((((...((...(((((.((((((((........)))))))).)))))))...)))).)))))..))))))))))).)))..........(((((......)))))((((.(((...))).))))((((((((......))))))))(((((.........))))))))))))))))))))))))..)))))).))))........)))))).))))).)))))))................)))))))))))))....)))...))))))))).....)))))....((((((((...))))))))............
Thermodynamic Ensemble Prediction
....((((((((((...))).}},((((,{((((({((.{..(((((({.,{({{(({{({,.{,((({{{{.({,{{.,((((,(((((((({,,,,.(({(,...{(({......,|||{{,.{,|{|{{|{,..}}})||,,.)),...))}))}})).))})))})},))))))),)})}).})))),,})}....,,(((((((((({{(((((...)))))||{..,{{{{,,...,.,,,{.....},))},,.(((..((((...))))..))){.((((((......{({.........)))...,..)))))).}.(((((.((((..((((.......................((((.....))))(((..((((..........))))..))).,)))}.)))))))))))))))))))((((((((.(((.(((...)))))).))))))))}.,)))))..)})))|,,||}},}|,}|}}||....|{{{|{{|({{,,,||||,{,{{{...))))))}(({{{(((((.....,..............,,....)))))))))...,{{(((({{((,,..}}}}}},.}},,(((((.({.....)))))))}}})},.)})}...,,,,,,,{{(({{,.{(((((((({{((((...{{.((((....(((((((.......(((((((((,....,,}))))))))(((((.(((....(((....)))...))).))))).........(((((((.(({...})).)))))))))))))).......(((((..((((.((((((((({{(((((((((((.{{.,((((,((((...{.,,.,((({.((((((((........)))))))).})))}.},.,)))),)))))..||))))))))).)))},........(((((......))))),{|,.|||.,,))}.}}},{(((((((......)))))))|(((((.........))))))))))))))))))))))))..)))).},)))),,......}}}}|||||||}.}))))))}}||,|||.||||.,,,...........,,},}},}}}))))))))},.....)))))....{(((((({...})))))))............

Transcripts

ID Sequence Length GC content
NM_001511.4 NCBI
ACAGAGCCCGGGCCGCAGGCACCUCCUCGCCAGCUCUUCCGCUCCUCUC… 1174 nt 0.4540
Summary

This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice and humans demonstrated that the CXCL1 mRNA is a potential marker for vital reactions in skin contusions, as its levels were significantly higher in antemortem wounded skin compared to intact skin and postmortem-injured skin [He et al. DOI:10.1007/s12024-018-9969-7]. In mice, increased mRNA expression persisted in contused skin up to 96 hours postmortem, while in human autopsy samples, elevated levels were detected up to 48 hours after autopsy in all five examined cases, indicating its forensic applicability for determining wound vitality. A study in mice demonstrated that the CXCL1 is a key mediator of UVB-induced inflammatory pain, showing significant upregulation in both human and rat skin at the peak of hyperalgesia with fold changes of 29.7 and 32.4, respectively, and its expression was strongly correlated between species [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a rat model of mild blast traumatic brain injury, the CXCL1 was identified as part of a broader inflammatory and vascular repair response, with its mRNA expression patterns showing intensity- and time-dependent changes following exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].