| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGACAUUCCUCAAUUGCUUAGACAUAUUCUGAGCCUACAGCAGAGGAA… | 1175 nt | 0.3745 |
This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. This gene may also be a key regulator of the 'cytokine storm' immune response to SARS-CoV-2 infection. [provided by RefSeq, Sep 2020] CIViC Summary for CXCL10 Gene
A study in mice demonstrated that myocardial infarction (MI) activates the cGAS-STING-IRF3 pathway in cardiac macrophages, leading to robust type I interferon (IFN) production and interferon-stimulated gene (ISG) expression, including the CXCL10 [King et al. DOI:10.1038/nm.4428]. In a rat model of cavernous nerve injury erectile dysfunction (CNI-ED), whole-transcriptome analysis identified the CXCL10 as a core hub gene with upregulated expression, and it was suggested to be regulated within a competing endogenous RNA network involving specific miRNAs [Huang et al. DOI:10.1080/21655979.2021.1973863]. A study in mice demonstrated that the CXCL10 was significantly upregulated (310.472-fold) in skeletal muscle at 12 hours following an incised injury, as identified through DNA microarray analysis [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. This finding was part of a broader transcriptomic investigation that identified numerous differentially expressed genes, with the temporal expression patterns of selected cytokines suggesting their potential utility for forensic wound age estimation.