Basic Information

Symbol
CXCL10
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 10 IP-10 GIP-10 SCYB10 IFI10 Crg-2 Mob-1 INP10 C7 Small Inducible Cytokine Subfamily B (Cys-X-Cys), Member 10 10 KDa Interferon Gamma-Induced Protein Small-Inducible Cytokine B10 C-X-C Motif Chemokine 10 Protein 10 From Interferon (Gamma)-Induced Cell Line Interferon-Inducible Cytokine IP-10 Chemokine (C-X-C Motif) Ligand 10 Gamma IP10 Gamma-IP10
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Wound age identification Other applications

MANE select

Transcript ID
NM_001565.4
Sequence length
1175.0 nt
GC content
0.3745

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-284.20 kcal/mol
Thermodynamic ensemble
Free energy: -306.04 kcal/mol
Frequency: 0.0000
Diversity: 253.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((....(((((((.....)))))))........))))))......)))))((((.((.((((.........))))))...))))((((((((((((.((((((.((((...((((.((((((((((..((((((((((...((((.........))))..)))).....((((.........)))).)))))).....((((((((((((..(((.....(((((((..((((((.(((.((((((...))))))....((((((((((..(((((((.((((..(((..(((((.(((((.(((((((((((((((((.......(((((..(((((...))))))))))..........(((((((............))))))).(((((((...(((.(((((...)))))......((((.((((((.((((((...((..(((..(((((((.........)))))))........((((((((....))))))))......)))))...)))))))))))).))))...)))...)))))))..))).))))))))...........(((((((.....(((.....)))...))))))).)))))).)))).).))).))..))).)))).))))))).))))))))))......(((.((....))..)))((((.((((.((((((((((...((....))..))))))))))....(((((((((............)))))))))((((....))))(((.((..(((((((.((((((..(((....))))))......(((((((((((....))))............(((((((((...(((((....))))).....)))))))))(((((....)))))..)))))))........))).)))))))..)).)))....((((((.....(((((((.(((((((((...................))))))).)).)))).)))))))))............)))).)))).....))).))))))...))))))).....))).)))))).)))))).........))))))))))..))))..)))).)))..............))))))))))...))))).....................
Thermodynamic Ensemble Prediction
(((((.((((((....(((((((.....)))))))....,...))))))......)))))((((.,..{((({,.......,}},)),,}))))((((((((((((.,{({,,.||||,..((((.((((((((((..((((((((((...((((.........))))..)))).....((((.........)))).)))))).....((((((((((((..(((.....(((((((..((((((.(((.((((((...))))))....((((((((((..(((((((.((((..(((..(((,(,((((,.,(((,,(((((((((((.,,,...(((({.,(((((...))))))))))...,,.....(((((((............))))))).(((((((...,,,.(((((...)))))......,(((.((((((.((((((...(,..{((..{((((((.........))))))}........((((((((....))))))))......)))))...)))))))))))),))}}...})}...}))))))..))).))))))))....}}}....||||{||.....,,,,,,{{{|{{{{||,,,,..,,))))}))))},,))},))..))).)))).))))))).)))))))))).....,{({.{(,...}}..}}}{{{{,({((,((((((((((.,.{(....},..)))))))}}}....{{{{{((((.,........,.}))}}}}}|(((({{,,||||{{,.,,,{(({{,,{.{{{{{{.,(({....}))))}......{{{{{{||{||....}}}}............(((((((((...(((((....))))).....))))))))),||||,,},),,,,..}))}))}||.,.|..}))})))))))|,}|||||..,,{((({{{{{{((,,,,||}}|||{{{||,,,..}}},},.....,},}||||||||.,}}}}|}},}}}}},..,,,.....,,)}}),,))),,,,.))).))))))...))))))).....))).))))))))))))).........)))))))))},.)))){{||||.|||.......))).}}}))))))))))...))))).....................

Transcripts

ID Sequence Length GC content
GAGACAUUCCUCAAUUGCUUAGACAUAUUCUGAGCCUACAGCAGAGGAA… 1175 nt 0.3745
Summary

This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. This gene may also be a key regulator of the 'cytokine storm' immune response to SARS-CoV-2 infection. [provided by RefSeq, Sep 2020] CIViC Summary for CXCL10 Gene

Forensic Context

A study in mice demonstrated that myocardial infarction (MI) activates the cGAS-STING-IRF3 pathway in cardiac macrophages, leading to robust type I interferon (IFN) production and interferon-stimulated gene (ISG) expression, including the CXCL10 [King et al. DOI:10.1038/nm.4428]. In a rat model of cavernous nerve injury erectile dysfunction (CNI-ED), whole-transcriptome analysis identified the CXCL10 as a core hub gene with upregulated expression, and it was suggested to be regulated within a competing endogenous RNA network involving specific miRNAs [Huang et al. DOI:10.1080/21655979.2021.1973863]. A study in mice demonstrated that the CXCL10 was significantly upregulated (310.472-fold) in skeletal muscle at 12 hours following an incised injury, as identified through DNA microarray analysis [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. This finding was part of a broader transcriptomic investigation that identified numerous differentially expressed genes, with the temporal expression patterns of selected cytokines suggesting their potential utility for forensic wound age estimation.