Basic Information

Symbol
CXCL2
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 2 SCYB2 CINC-2a MIP-2a MGSA-B GROb GRO2 Macrophage Inflammatory Protein 2-Alpha Chemokine (C-X-C Motif) Ligand 2 Growth-Regulated Protein Beta C-X-C Motif Chemokine 2 GRO2 Oncogene MIP2-Alpha Gro-Beta MIP2A Melanoma Growth Stimulatory Activity Beta MGSA Beta MIP2 GROB
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_002089.4
Sequence length
1115.0 nt
GC content
0.4466

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-322.50 kcal/mol
Thermodynamic ensemble
Free energy: -343.63 kcal/mol
Frequency: 0.0000
Diversity: 262.80
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((...((((((((.(((..((((((((..(((((.((((((((((((........((((((((.(((((...((((....)))).((.....)).((.....)).......)))))..)))))))).)))).)))....(((((((.((..((((....))))..)).)))))))((..(((((..(........)..))))).)).(((((...)))))((((.(((((((.....((((.....))))..))))))).)))).......(((((..(((((......(((.........)))......)))))...((((((.((((...((.(((((..(.((((((.....)))))).)....))))).......(((((........)).)))...))...))))))))))...)))))(((((((((.(((.(((...)))))).)))))))))..)))))..))))).((((....((..((((((.((((((.(.....(((((......((((((...((((((((((((((......((..((......))..)).......))))))))(((((.((...(((..(((((........(((((.((((((((..(((((........((.(..(((.........)))..).)).......)))))..)))))))).))))))))))..)))...)).)))))..(((.(((((((((....))).)))))).)))..))))))))))))......))))).((((((.(((...))).))))))).)))))).)....)))))..)).......))))..))))))))..))).)))).)))).)))))).(((((..((((.....(((((........)))))....)))).))))).(((((..((((((....((((((((((((.......((((((((((............)))))))))).(((((......)))))(((((((...(((.......)))...)))))))....((((((......)))))))))))))))))).....)))))).)))))..............................
Thermodynamic Ensemble Prediction
((((((...((((((((.(((..((((((((..(((((.(((((((,((((.((.....,{{{{{||.(((({...((((....)))}.||....,|{{((,,.,{||.......}))),..)}))))))))},),})},,,,(((((((.((,,((((....))))..)).)))))))|{,.,,|||{,{,,....{{|,,}}}))})).(((((...)))))((((.(((((((,....((({.....)))),.))))))).))))..||...{{{{{,.(((((......{((.........}))......)))))...((((((.((((...,{.(((((..,.((((((.....)))))).}....))))).......{(({{...,,..,|}.|}}...))..,))))))))))..})))))(((((((((.(((.(((...)))))).)))))))))..)))))..))))).((((..,.((..((((({.((((((.(.{{{{({(((......{{{|||,}}||((((((((((((......{{..{(......})..}}.......))))))))|||{{.{,..,(((,,({{{{..,,,,,.(((((.((((((((..(((((........((.{..(((.........)))..}.)).......)))))..)))))))).)))))}}}}}..}}}..,}},|}}|||.(((.(((((({{,....,)}.)))))).))}.}))))))||||||...,}}))),,.((((((.(({...})).))))))).)))))).)....)))))..)).......))))..))))))))..))).)))).)))).))))))..((({...,,{((((((({{{.,.{{,,{||{{||||,,,.{((({...})))|(((((((.....})))))}.(((({((((((((((((((((.,..........)))))))))).}),,,}}},.,}))))(((((((.,,(,{,,.....})},}.)))))))...(((((,({{....))),)))))}}}}))))},})}}}}|||||||,,.....}}}}..,,}},...............

Transcripts

ID Sequence Length GC content
ACAGAGCCCGGGCCACAGGCAGCUCCUUGCCAGCUCUCCUCCUCGCACA… 1115 nt 0.4466
Summary

This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the CXCL2 contributes to ultraviolet-B-induced mechanical hypersensitivity [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate study of human and rat corpus cavernosum, the CXCL2 was identified as a chemokine ligand involved in immune-related CXCL signaling, with ligand isoforms highly expressed in rats [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in rats demonstrated that the CXCL2 is up-regulated at 1-3 hours post-injury in skeletal muscle contusion, where it was identified as a hub gene involved in the TNF signaling pathway and exhibited time-dependent expression patterns useful for wound age estimation [Li et al. DOI:10.1042/BSR20203699].