| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAGCCCGGGCCACAGGCAGCUCCUUGCCAGCUCUCCUCCUCGCACA… | 1115 nt | 0.4466 |
This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CXCL2 contributes to ultraviolet-B-induced mechanical hypersensitivity [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate study of human and rat corpus cavernosum, the CXCL2 was identified as a chemokine ligand involved in immune-related CXCL signaling, with ligand isoforms highly expressed in rats [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in rats demonstrated that the CXCL2 is up-regulated at 1-3 hours post-injury in skeletal muscle contusion, where it was identified as a hub gene involved in the TNF signaling pathway and exhibited time-dependent expression patterns useful for wound age estimation [Li et al. DOI:10.1042/BSR20203699].