Basic Information

Symbol
CXCL3
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 3 SCYB3 CINC-2b MIP-2b GROg GRO3 Macrophage Inflammatory Protein 2-Beta Chemokine (C-X-C Motif) Ligand 3 Growth-Regulated Protein Gamma C-X-C Motif Chemokine 3 GRO-Gamma(1-73) GRO3 Oncogene GRO-Gamma MIP2-Beta Melanoma Growth Stimulatory Activity Gamma MGSA Gamma MIP2B GROG
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_002090.3
Sequence length
1075.0 nt
GC content
0.4474

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-312.30 kcal/mol
Thermodynamic ensemble
Free energy: -334.90 kcal/mol
Frequency: 0.0000
Diversity: 235.33
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((..((.(((........))).))...))))....(((...(((((...((.((((..((((.(((....))).)).)).))))))..(((((((((.(((........)))...).)))))))).((((((...((((((((.((..((((....))))..)).))))))))...(((((...(((.((.((..((((((((((((((...)))))))..((((((((...((...))...)).))))))....(((((...))))).))))).))......)).)))))..))))).....((((((((......((((((.((((((((.(((((.(((..((((((...(((........))).))))))..(((((.((((..(((.(((((.((...(((((.(((....)))...)).)))...)))))))))))))).)))))((((((...(((((((................))))..((((((((......))))))))(((.......)))........)))...))))))..(((........)))..(((((((((((((.((((...........)))).)))....))))))))))(((((((((((....))))))).))))(((((.((((..((.((((...((((((.(((...))).))))))....))))))..)))).)).)))......((.((..((((((((........)))))))).))))))).))))).)))).))))...))))))....((.(((..(((.((((.((((..((((((.((.((((((............(((((((....)))))))(((((.((.....((((....))))...)).))))))))))).)))))))))))).))))))).))))).((((((...))))))......(((((((...))))))).......)))))))))))))).((((((((((...)).)))))))).((((((....(((..(((((....))))))))))))))...)))))...))).......
Thermodynamic Ensemble Prediction
.....{,.,(((..((.(((........))).||...}}}}|,...,|,..||||,...|{.{{{{,,||{(,(({....||}.||,|}.||||||..((((((((.{(({........)}}.,}).)))))))),{(((((...{((({(((,({..{{||....)))).,)),)))))))),.,||||(,,.{({{((,((.,(({(((((((((((...)))))))..((((((((...{,...,}...)).))))))....(((((...))))).))))).))......}}.}))}}..))))).....((((((((....,,(({{{{.((((((((.(((((.(((..((((((...(((........))).))))))..(((((.((((..(((.((((((,,..,({{{{.(({....}))...}}.))}...}))))))))))))).)))))((((((...{((((((................}}})..((((((((......)))))))).,{.....,||}},.,,....)),...))))))..{((........))}..(((((((((((((.((((...........)))).)))....))))))))))(((((((((({....))))))).)))){((((.((((..{,{((((...((((((.(({...})).))))))....)))))}..)))),)).||)|,....},}||..((((((((........)))))))).,..}))).))))).)))).))))...||||||,...{(.(((..(((.((((.((({,,((((((.((.((((((............(((((({....)))))))(((((.((.,{..,{{,....,}}}.,.)).))))))))))).)))))))))))).))))))).)))}}.((((({...})))))|},,,,||(((({...}))))))}}}....)))))))))))))),((((((((((...))))))))))).(((((((,..(((,{(,,,,,,,.}}}))}})))))))...,}))},..})}.......

Transcripts

ID Sequence Length GC content
ACACAGCCCGGGUCGCAGGCACCUCCCCGCCAGCUCUCCCGCUUCUCGC… 1075 nt 0.4474
Summary

This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the CXCL3 was significantly upregulated at 2 days post-injury and downregulated at 14 days post-injury following controlled cortical impact, indicating a time-dependent role in promoting neutrophil migration during the acute neuroinflammatory response to traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in rats demonstrated that the CXCL3 was significantly downregulated in the left ventricle of animals with acute right heart failure induced by pulmonary artery banding [Cao et al. DOI:10.1177/2045894019879396]. In a separate investigation of ultraviolet-B-induced inflammatory pain, RNA-sequencing in both human and rat skin showed the CXCL3 was highly upregulated at the peak of hyperalgesia, with a fold change of 29.5 in human skin and 73.4 in rat skin, indicating its role as a potential pain mediator in this translational model [Dawes et al. DOI:10.1371/journal.pone.0093338].