| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAGCCCGGGUCGCAGGCACCUCCCCGCCAGCUCUCCCGCUUCUCGC… | 1075 nt | 0.4474 |
This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. [provided by RefSeq, Sep 2014]
A study in mice demonstrated that the CXCL3 was significantly upregulated at 2 days post-injury and downregulated at 14 days post-injury following controlled cortical impact, indicating a time-dependent role in promoting neutrophil migration during the acute neuroinflammatory response to traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in rats demonstrated that the CXCL3 was significantly downregulated in the left ventricle of animals with acute right heart failure induced by pulmonary artery banding [Cao et al. DOI:10.1177/2045894019879396]. In a separate investigation of ultraviolet-B-induced inflammatory pain, RNA-sequencing in both human and rat skin showed the CXCL3 was highly upregulated at the peak of hyperalgesia, with a fold change of 29.5 in human skin and 73.4 in rat skin, indicating its role as a potential pain mediator in this translational model [Dawes et al. DOI:10.1371/journal.pone.0093338].