Basic Information

Symbol
CXCL5
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 5 ENA-78 SCYB5 Small Inducible Cytokine Subfamily B (Cys-X-Cys), Member 5 (Epithelial-Derived Neutrophil-Activating Peptide 78) Epithelial-Derived Neutrophil-Activating Protein 78 Neutrophil-Activating Peptide ENA-78 Chemokine (C-X-C Motif) Ligand 5 C-X-C Motif Chemokine 5 Neutrophil-Activating Protein 78 Small-Inducible Cytokine B5 ENA-78(1-78) ENA78
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_002994.5
Sequence length
2436.0 nt
GC content
0.3707

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-646.80 kcal/mol
Thermodynamic ensemble
Free energy: -698.51 kcal/mol
Frequency: 0.0000
Diversity: 638.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((.((..((.((((((.((((((((((((..(((.....((((..........(((((..((((((((((.((((.............))))...))))(((((.((((((.(((......))).)).....((.......)))))).))))).((((((((((((((....)))))..(((((.((.((.((((((.....(((...(((((..(((.(((((((.(.((((((..(((....))).)))))).)))))).)).)))......)))))....))))))))).)).)).))))).......((((...)))))))))))))(((.(((((((..((((((...((((.((((((((.((...((...((((((.......((.((((((....)))))).))))))))...))....)))))))))).)))).................))))))..)))))))..)))..((((((((.((.(((((((.((((((..((((((.((.(((....))).)).)))))).............(((((.((........))..)))))((((((((..........)))))))).......((((((((((.(((((((.(((..(((..((((((((..((((((((((....)))))..))))).))))))))..)))..)))...))))))).)))..((((..........((((((......)))))).........))))(((((((.((((((((((.((.....(((((((...)))))))....((((((((((((..((((((..(((((..(((((((...........(((..((....))..)))........))).))))..))))).....(((((...(((((((.(((((((((((((...)))).))))))))).)))))))...)))))..(((((((((((.........((((......))))....))))))))))))))..)))..))..........(((((((..(((((((..........)))))))))))))).))))))))))))..)))))))))).))))))).............(.((((((...))))))).((((((((.(((((.......(((((.(((((((..((((((..((((.((..(((((......))))).)).)))).)))))))))))))......(((((((....((((......))))....)))))))........))))).......)))))..)))))))))))))))...........((.(((((((...((((((((((.(((((((((...)))))))))..............((((((......))))))(((((((((.((((.((..(...((((((.....))))))...)..)).)))).)).((((........))))................(((.......)))...))))))).....((((.(((.......))).)))).))))))))))...............((((.......))))...((((((....))))))((((.(((((.(((((((...............))).))))..)))))))))...))))))).))))))))))))))).)).))))))))))))))..)))))...((((((.......))))))))))....))).((((...(((((((((((((..(((((((((......))))))........))).)))))))))))))...))))))))))))))..)).))))))..))....))..))))..)))((((((((((...........))))))))))...((((((....................))))))...........(((((((((((.............(((..((((.(((((..(((((((((.....((((....))))..............(((((((((((.((..((((............))))...........((((((((.(((((.....))))).(((((...((((((...)))))).))))).........))))))))....(((((((...(.(((.((((.((((((....(((((((.........)))))))........(((((((..(((((((((((((....))))))))))))).))))))).((((...)))))))))))))).)))).))))))).)).)))))))))))..((.((((((.((((((((((.........)))))..)))...)).)))))).)).)))))))))...))))).))))..))).((((.(((((((........))))))).))))...)))))))))))....
Thermodynamic Ensemble Prediction
...{,({{{{((.,,.,||.((((((.((((((((((((({({{,,{,,{(((,,..,,{{,.(((((..((((((((((,((((....,....,...)))}...,,|,{{|({,{{{{{|,{{{.,,,,,||},||..,|{({{|||||||,||||{|,|||||}}||{.(((((({.,,,|||||{|{|||{||,||.,,,))}}}}}}}}}.,||}||{,{.{{{.{|{|||{,(.{(({((,,(,,..,,))).))))))}}))))).}}.}},...,..,,,...,|||{..(((((((((,,.}}}((((..{{,,,|}..})))..))))}..(((((({{......)))||))..((((.((((((({,((...,,{{{((((((.......{{.((((((....)))))).}})))))}..}))....)))))))))).)))))))))),|..(({,....)))),.})},,}})}})},..((((((((.((.(((((({{((((((..((((((.((.(((....})).)).)))))).,||,,,{{{{|,{((((.((........||,.))))}((((((((.,{....},.))))))))....,,.((((((((((.(((((((.(((..(((..((((((((..((((((((((....)))))..})))).))))))))..)))..)))...))))))).)))..,{{(,.........((((((......)))))).........,,,,{((((((.((((((((((.({.....(((((((...)))))))....((((((((((.{,,{,{(((,(((((({{{..{((((((.,....}}))))},{{,{{{{{.,,,.{|||{{,....{,{((({{(((..{{.,{(((...(((((((.(((((((((((({...)))).))))))))).)))))))...)))))}..)))))))),........,,||||||.,||||,,.,}|}||},}})))))))}.))|,,||.,,,,,}},,|||{{{{.,||{{{{|.,.....,,,)))))))})})))}.)))))))))),}..)))))))))).))))))},,,,,,,,...,,{.((((({...}))))),.{{((((({.{({((..{{,,,{{{({,(((({{{..{|((({..,{{{,||,,(((((......))))).)),}},}.}}}})}))))}))}}}}},{((((((....((((......))))....))))))),{{{{,,,,}}}},.,.,,.}))))..)))))))}))))))).,,|||,....||.{((({((...{(((((((({.(((((((({...}))))))))..............((((((......))))))((((((({{..((...,.(({{(((((((((....,....{{{{.,....)))})..((((........}})}.............))))))))))}}))))..)))))))).....((((.(((.......))).)))).)))))))))},,.....,},,,,,,||{{.......)))}...||{{{|,...})}},,{(((.(((((.(((((((..,{....,,}))}.....})))..))))))))}...})))))}.),))))))))))))).)).))))))))))))))..))))),,.((((((.......))))))||||{{{,||,,((({...((((({{{{{{{{..|||{{{,{,|,,,,,)))}}}..,,,,,.))).})}}))))))))}...}})))))))))))).,)).)))))).,||,...,,.,)))}...,.{(((((((((...........)))))))))|,,,((,,,,.,,,,}|{........}},.,,))),...........(((((((((((.,,..,,,....,|{|,.((((.(((((..(((((((((...,.((((....)))}..............(((((((((((.{(,,,{(,{{{{{{.,{{,.||||||,,.......,{{{{(((,(((((.....}}}}}.(((((...((((((...)))))).))))).......,.}}))))}|,|||{{{,,,||||||||,.,,,|,||||{{....(((((((.........)))))))||,.....(((((((..(((((((((((((....))))))))))))).))))))){((((...)))))))),,}))}.))))})..))}}.)).))))))))))).,{{.{{{{{{.{|({{(((((.........)))))..}}}..}}}.,}}}},.)}.))))))))).,.))))).))))..}}}.{(((.(((((((........))))))).)))}...)))))))))))....

Transcripts

ID Sequence Length GC content
ACAGUGCUCCGGAUCCUCCAAUCUUCGCUCCUCCAAUCUCCGCUCCUCC… 2436 nt 0.3707
Summary

This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils, to promote angiogenesis and to remodel connective tissues. This protein is thought to play a role in cancer cell proliferation, migration, and invasion. [provided by RefSeq, May 2013]

Forensic Context

A study in mice demonstrated that the CXCL5 was the most upregulated gene throughout the post-injury period in incised skeletal muscle wounds, showing high expression from 6 through 36 hours with a significant decrease at 48 hours, and its distinct temporal expression pattern, along with other cytokines, suggests potential for forensic wound age estimation [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027].