Basic Information

Symbol
CXCL8
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 8 MDNCF NAP-1 MONAP GCP-1 Monocyte-Derived Neutrophil Chemotactic Factor Monocyte-Derived Neutrophil-Activating Peptide Granulocyte Chemotactic Protein 1 Chemokine (C-X-C Motif) Ligand 8 SCYB8 LYNAP LUCT LECT IL-8 GCP1 NAP1 NAF IL8 Beta Endothelial Cell-Derived Neutrophil Activating Peptide Lung Giant Cell Carcinoma-Derived Chemotactic Protein Lymphocyte Derived Neutrophil Activating Peptide Alveolar Macrophage Chemotactic Factor I Tumor Necrosis Factor-Induced Gene 1 Neutrophil-Activating Peptide 1 T-Cell Chemotactic Factor Interleukin 8 Interleukin-8 Emoctakin AMCF-I B-ENAP TSG-1 3-10C K60 Small Inducible Cytokine Subfamily B, Member 8 Beta-Thromboglobulin-Like Protein Neutrophil-Activating Protein 1 C-X-C Motif Chemokine 8 Protein 3-10C
Location (GRCh38)
4:73740519-73747379
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Wound age identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000584.4
Sequence length
1642.0 nt
GC content
0.3289

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-397.30 kcal/mol
Thermodynamic ensemble
Free energy: -428.18 kcal/mol
Frequency: 0.0000
Diversity: 411.28
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.((..((((((((((.((((((((.((((.((((((((....(((((((.((..((((.((..((.......(((.(((......))))))........))..)))))).)))))))))(((((((..(((((((.((..(((((((...((((((((........(((((.((((.....))))(((((..........)))))))))).......(((((.(..((((..(((......)))....))))..).)))))....)))))))).)))))))...........((((((((......))))))))((.((((.((((..((.....)))))).)))).))...)).)))))))......)))))))((((((..((......))..))))))(((((.(((((((..(((.((.......)).)))..)))..((((.((((((..(((.((.....)).))).)))))).)))).((((((((((((((..((((((.((((.((((((((((((((((((((....((((((((......))))))))....))))))............(((((((.(((((.(((((((..(((.............))).)))))))))))).))))))).((((((((...........)))))))).((((..((((((......((((...))))........(((((...((((((((...)))))))))))))))))))...))))..........(((((........)))))((.(((......)))))......)))))))))))))).)))).))..........))))..))))))))))))))............))))))))).)))))...((((((..(....((.....)).......)..))))))((((((((.((((.((((....((((((((.....))))))))....))))..((((((.((((..(((...........)))..))))..)))))).........................((((((((.....((((((.........((((((..((((.......(((((((((((.(((((((((...(((..((((((((((.....(((((........))))).....))))))))))..)))......))))))))))))))...................((((((....))))))..))))))(((((((((((((((......((((........))))......)))))))))))))))....(((((((((.......)))))))))....))))))))))((((((((((...))))))))))(((((......)))))(((((((.((.(((((((((...(((....((((.......(((((..((((((....))))))))))).....))))....)))...))))).)))).))..)))))))....))).))).....)))))))).))))..)))))))).......))).))))...))))))))..............))))))))))..)).))..................(((((((..(........)..)))).)))......
Thermodynamic Ensemble Prediction
.{{.((..((((((((((.((((((((.{(((,(((.{(,{,,{,|||.||||{{,,.....((,,(((((((...(((.(((.(..{(((.(((((((..((((((...((({,,{{({(((,,(((({{(((((((((((((((((((...((((((((........(((((.((({.....))))(((((..........)))))))))).......(((((,{({({((..(((......))),,,.},))).).)))))....)))))))).)))))))...........((((((((......)))))))),(.((((.((((..{(.....)))))).)))).))))))))))}||||{,{...))))))){(((((,.,,......}},.}})))).,{((,,{||},,},}}}},}}}).))))),,||....,,,((((.((((((..(((.((.....)).))).)))))).)))).((((((((((((((..(({{((.((((,({((((((((((((.{({,,....((((((((......)))))))).((.{{.|(((((.,({{.,..(((((((.(((((.(((((((..(((.............,}}.)))))))))))).))))))).,|.}}|||.))))),.)}.)),.|{(((((((..((((((,.,,..((((...))))..,.....,{(((...((((((((...)))))))))))))))))))...)))}}))))}....(((((........)))))((.(((......)))))....,.)))))))))))))).)))).}){{......,,)))}..))))))))))))))}}}.))))))..))).....,))))..))))}))).)))...))))))))))....||||,.,{{|||{(({,{,,.,((|.{(((....((((((({.....})))))))....))))..||{{{,.,|{||}|||}|,....{{{{{{|,.||,,..,|||||,,......,,,,,...,|,.}}}}||||,.,,{,{{..{(({({,.,,,||}}}|{,|,,,|}},}.,}}}},,,}}}}{{{{.{((((((((,,.{({{,((((((((({.,,{,(((((.,......}}}}},||..}))))))))}..,}},}},..))))))))}})))},,,,.,,............,{{(((,...}}||||.,{{{...(((((((((((((((..,...((((........)))}...}}.)))))))))))))))...,|||{||||{.....,,)))))))}}..,,}.,|}}}}}}((((((((((...))))))))))(((((......))))),{{{{{(,((,(((({((({...{{(....{{{{.......((({,,,((((({....))))))))))).....)))}....}}}...})))).)}}}.}}..))}|||||{{{||...,)}},,.}))}}).,.))))..}}},}))},}}}}..))),)}})...))))))))....,......,..))))))))))..)).})...,,,,...........{{{{(({..{........,..)))).)))......

Transcripts

ID Sequence Length GC content
NM_000584.4 NCBI
ACAAACUUUCAGAGACAGCAGAGCACACAAGCUUCUAGGACAAGAGCCA… 1642 nt 0.3289
NM_001354840.3 NCBI
ACAAACUUUCAGAGACAGCAGAGCACACAAGCUUCUAGGACAAGAGCCA… 2058 nt 0.3222
Summary

The protein encoded by this gene is a member of the CXC chemokine family and is a major mediator of the inflammatory response. The encoded protein is commonly referred to as interleukin-8 (IL-8). IL-8 is secreted by mononuclear macrophages, neutrophils, eosinophils, T lymphocytes, epithelial cells, and fibroblasts. It functions as a chemotactic factor by guiding the neutrophils to the site of infection. Bacterial and viral products rapidly induce IL-8 expression. IL-8 also participates with other cytokines in the proinflammatory signaling cascade and plays a role in systemic inflammatory response syndrome (SIRS). This gene is believed to play a role in the pathogenesis of the lower respiratory tract infection bronchiolitis, a common respiratory tract disease caused by the respiratory syncytial virus (RSV). The overproduction of this proinflammatory protein is thought to cause the lung inflammation associated with csytic fibrosis. This proinflammatory protein is also suspected of playing a role in coronary artery disease and endothelial dysfunction. This protein is also secreted by tumor cells and promotes tumor migration, invasion, angiogenesis and metastasis. This chemokine is also a potent angiogenic factor. The binding of IL-8 to one of its receptors (IL-8RB/CXCR2) increases the permeability of blood vessels and increasing levels of IL-8 are positively correlated with increased severity of multiple disease outcomes (eg, sepsis). This gene and other members of the CXC chemokine gene family form a gene cluster in a region of chromosome 4q. [provided by RefSeq, May 2020]

Forensic Context

A study in humans demonstrated that serum CXCL8 levels were significantly increased in patients with sepsis compared to healthy controls and showed a positive correlation with the CXCL8 and other inflammatory markers [Xu et al. DOI:10.3892/mmr.2022.12850]. A study in pigs demonstrated that in a combined trauma model, local IL-8 levels in fracture hematoma were significantly higher than systemic serum levels, but these local levels were attenuated in the hypothermic trauma group compared to the normothermic group, while systemic IL-8 was significantly higher in the hypothermic group at 48 hours [Horst et al. DOI:10.1371/journal.pone.0154788]. In human skin after thermal injury, microarray analysis identified IL-8 as a validated pro-inflammatory cytokine gene that was highly expressed, peaking in the middle wound healing period (4-7 days post-burn) [Greco et al. DOI:10.1016/j.burns.2009.06.211].